Incidental Mutation 'R4615:Ncapg'
ID345014
Institutional Source Beutler Lab
Gene Symbol Ncapg
Ensembl Gene ENSMUSG00000015880
Gene Namenon-SMC condensin I complex, subunit G
Synonyms5730507H05Rik, MFT.M05.13, Hcapg
MMRRC Submission 041826-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location45669919-45700546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45687399 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 579 (M579L)
Ref Sequence ENSEMBL: ENSMUSP00000112871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117396]
Predicted Effect probably benign
Transcript: ENSMUST00000117396
AA Change: M579L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112871
Gene: ENSMUSG00000015880
AA Change: M579L

DomainStartEndE-ValueType
Pfam:Cnd3 557 863 7.4e-87 PFAM
low complexity region 864 874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134309
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198274
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the condensin complex, which is responsible for the condensation and stabilization of chromosomes during mitosis and meiosis. Phosphorylation of the encoded protein activates the condensin complex. There are pseudogenes for this gene on chromosomes 8 and 15. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcdhb4 T A 18: 37,308,500 S288T probably benign Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Ncapg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ncapg APN 5 45693160 missense possibly damaging 0.53
IGL00777:Ncapg APN 5 45695765 missense possibly damaging 0.93
IGL00857:Ncapg APN 5 45676585 splice site probably null
IGL00916:Ncapg APN 5 45671192 missense probably benign 0.37
IGL01293:Ncapg APN 5 45681854 missense probably benign 0.01
IGL01360:Ncapg APN 5 45674385 nonsense probably null
IGL01462:Ncapg APN 5 45671135 missense probably benign 0.02
IGL01527:Ncapg APN 5 45672384 missense possibly damaging 0.71
IGL01732:Ncapg APN 5 45693853 missense probably damaging 1.00
IGL01788:Ncapg APN 5 45671081 missense probably damaging 0.97
IGL01871:Ncapg APN 5 45688581 missense probably benign 0.09
IGL03106:Ncapg APN 5 45695668 missense probably damaging 1.00
IGL03124:Ncapg APN 5 45671209 missense probably benign
R0086:Ncapg UTSW 5 45676744 splice site probably null
R0109:Ncapg UTSW 5 45693748 splice site probably null
R0110:Ncapg UTSW 5 45693147 unclassified probably benign
R0377:Ncapg UTSW 5 45693817 missense probably benign
R0432:Ncapg UTSW 5 45672428 missense probably damaging 0.99
R0637:Ncapg UTSW 5 45687324 missense probably damaging 1.00
R0835:Ncapg UTSW 5 45681448 missense probably damaging 0.96
R0894:Ncapg UTSW 5 45679894 missense probably null 0.24
R1069:Ncapg UTSW 5 45675930 intron probably benign
R1216:Ncapg UTSW 5 45699919 missense possibly damaging 0.68
R1967:Ncapg UTSW 5 45699910 missense probably damaging 0.99
R2396:Ncapg UTSW 5 45678373 missense probably benign 0.00
R3157:Ncapg UTSW 5 45676058 missense probably benign
R3735:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3736:Ncapg UTSW 5 45696127 missense probably benign 0.00
R3887:Ncapg UTSW 5 45674363 missense probably benign
R4371:Ncapg UTSW 5 45678455 missense probably benign
R4545:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4546:Ncapg UTSW 5 45671212 missense probably damaging 1.00
R4558:Ncapg UTSW 5 45676644 missense probably benign 0.00
R4938:Ncapg UTSW 5 45671209 missense probably benign
R5839:Ncapg UTSW 5 45672278 missense probably damaging 0.99
R5871:Ncapg UTSW 5 45695697 missense probably damaging 1.00
R6086:Ncapg UTSW 5 45693236 missense probably damaging 1.00
R6418:Ncapg UTSW 5 45681816 missense probably damaging 1.00
R6617:Ncapg UTSW 5 45670132 missense probably benign 0.03
R7145:Ncapg UTSW 5 45670030 missense possibly damaging 0.82
R7408:Ncapg UTSW 5 45695793 missense probably benign 0.00
R7443:Ncapg UTSW 5 45672310 missense probably benign 0.31
Z1088:Ncapg UTSW 5 45679880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTTGGATAAGGTTCCCAAAGG -3'
(R):5'- AGCAGAAGATCCAGAATGGCTATC -3'

Sequencing Primer
(F):5'- GGAACAAAGAGTAACAATCTGCC -3'
(R):5'- AGATCCAGAATGGCTATCTGTAG -3'
Posted On2015-09-25