Incidental Mutation 'R4615:Pcdhb4'
ID345054
Institutional Source Beutler Lab
Gene Symbol Pcdhb4
Ensembl Gene ENSMUSG00000045689
Gene Nameprotocadherin beta 4
SynonymsPcdhbD, Pcdhb5A
MMRRC Submission 041826-MU
Accession Numbers

Ncbi RefSeq: NM_053129.3; MGI:2136738

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4615 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location37307455-37311172 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37308500 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 288 (S288T)
Ref Sequence ENSEMBL: ENSMUSP00000059770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051754] [ENSMUST00000056712] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably benign
Transcript: ENSMUST00000051754
SMART Domains Protein: ENSMUSP00000059180
Gene: ENSMUSG00000045498

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
CA 44 131 6.29e-1 SMART
CA 155 240 7.16e-21 SMART
CA 264 345 1.22e-23 SMART
CA 368 449 2.86e-20 SMART
CA 473 559 2.55e-26 SMART
CA 589 670 1.11e-8 SMART
Pfam:Cadherin_C_2 687 770 9.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056712
AA Change: S288T

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000059770
Gene: ENSMUSG00000045689
AA Change: S288T

DomainStartEndE-ValueType
CA 54 131 1.66e0 SMART
CA 155 240 1.07e-19 SMART
CA 264 344 6.03e-28 SMART
CA 367 448 2.57e-22 SMART
CA 472 558 3.36e-26 SMART
CA 588 669 3.48e-10 SMART
Pfam:Cadherin_C_2 685 768 1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193025
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,334 I363V probably benign Het
Abcc9 C G 6: 142,689,107 A144P possibly damaging Het
Adgrv1 C T 13: 81,494,569 probably null Het
Adprhl1 A G 8: 13,242,250 probably null Het
Angptl3 A T 4: 99,031,361 E119D probably benign Het
Atp8b1 T C 18: 64,553,099 N671S probably null Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Carmil2 A G 8: 105,695,074 D1019G possibly damaging Het
Cdh8 A T 8: 99,279,622 I111K probably damaging Het
Cep120 T C 18: 53,714,841 R649G probably damaging Het
Clptm1l A T 13: 73,607,738 K158* probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cnga1 A C 5: 72,604,774 L466V probably damaging Het
Cpsf1 T C 15: 76,596,937 T1240A possibly damaging Het
Cubn A G 2: 13,428,749 S1117P probably damaging Het
Cyp2b9 T A 7: 26,201,125 L396Q probably damaging Het
Cyp8b1 A T 9: 121,916,098 L56* probably null Het
Dcbld2 A G 16: 58,456,094 T458A probably benign Het
Dio2 G T 12: 90,729,821 P131Q probably damaging Het
Dlg5 T C 14: 24,158,168 Y990C probably damaging Het
Dsc3 T C 18: 19,971,488 D594G possibly damaging Het
Dsp A G 13: 38,191,632 E1131G probably damaging Het
Fdx1 A T 9: 51,948,645 Y21* probably null Het
Gal3st4 A G 5: 138,266,263 V158A probably damaging Het
Gm10269 T A 18: 20,682,763 E67D probably benign Het
Gm5773 A G 3: 93,774,032 H337R probably benign Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gng2 C T 14: 19,891,327 V16I possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Lama2 C A 10: 26,981,524 V3110F probably damaging Het
Mtmr4 T C 11: 87,610,935 L548S probably damaging Het
Ncapg A T 5: 45,687,399 M579L probably benign Het
Olfr1338 T C 4: 118,754,137 T134A probably benign Het
Olfr292 T C 7: 86,694,728 S91P probably damaging Het
Oog3 A T 4: 144,158,329 Y346N probably benign Het
Orm2 A G 4: 63,363,299 D89G probably damaging Het
Pcsk2 G T 2: 143,795,969 C375F probably damaging Het
Pdcd10 T C 3: 75,521,091 I138M probably damaging Het
Pde8a T C 7: 81,320,737 W536R probably damaging Het
Phkg2 C T 7: 127,577,620 R61W probably damaging Het
Plcl1 A T 1: 55,698,134 N878I probably benign Het
Prkdc A T 16: 15,663,074 D353V probably damaging Het
Psme4 C T 11: 30,834,287 T954I probably benign Het
Ran A G 5: 129,022,098 I115V probably benign Het
Reln A G 5: 21,972,872 L1867P possibly damaging Het
S100a1 A G 3: 90,511,255 V84A possibly damaging Het
Sall2 G A 14: 52,312,750 P994L probably benign Het
Shtn1 A T 19: 59,022,216 I273N probably benign Het
Slc17a9 T C 2: 180,731,906 I40T probably benign Het
Slc29a2 T C 19: 5,029,264 V305A probably damaging Het
Ssfa2 A G 2: 79,662,382 E1091G probably damaging Het
Taar2 T A 10: 23,941,365 F268I probably benign Het
Taf3 G A 2: 9,952,090 T422I probably damaging Het
Tgs1 T C 4: 3,585,156 F99L probably damaging Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Ttn A G 2: 76,766,875 I19898T probably damaging Het
Ulk1 G T 5: 110,789,046 T3N probably damaging Het
Vars A T 17: 35,013,881 K900N probably damaging Het
Vmn2r15 A G 5: 109,293,482 V170A possibly damaging Het
Vmn2r53 A T 7: 12,582,302 L530Q probably damaging Het
Zar1l G T 5: 150,518,063 Q33K probably benign Het
Zdhhc16 T C 19: 41,943,683 V358A possibly damaging Het
Other mutations in Pcdhb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Pcdhb4 APN 18 37309916 missense possibly damaging 0.68
IGL01319:Pcdhb4 APN 18 37308513 missense probably benign
IGL01325:Pcdhb4 APN 18 37309623 missense probably damaging 1.00
IGL01608:Pcdhb4 APN 18 37308750 missense probably damaging 1.00
IGL01808:Pcdhb4 APN 18 37309014 missense probably damaging 1.00
IGL01962:Pcdhb4 APN 18 37309004 missense possibly damaging 0.90
IGL02280:Pcdhb4 APN 18 37307682 missense probably benign 0.00
IGL02622:Pcdhb4 APN 18 37309668 missense probably benign 0.00
IGL03025:Pcdhb4 APN 18 37309977 missense possibly damaging 0.62
IGL03137:Pcdhb4 APN 18 37308516 missense probably damaging 0.98
P0031:Pcdhb4 UTSW 18 37308885 missense probably damaging 1.00
R0385:Pcdhb4 UTSW 18 37309215 missense probably damaging 1.00
R0611:Pcdhb4 UTSW 18 37308210 missense probably damaging 1.00
R0671:Pcdhb4 UTSW 18 37307742 missense probably benign 0.01
R0738:Pcdhb4 UTSW 18 37308711 missense probably damaging 1.00
R0853:Pcdhb4 UTSW 18 37309885 nonsense probably null
R0893:Pcdhb4 UTSW 18 37309370 unclassified probably null
R1932:Pcdhb4 UTSW 18 37309541 missense probably benign 0.33
R1945:Pcdhb4 UTSW 18 37308868 missense probably damaging 1.00
R2194:Pcdhb4 UTSW 18 37308735 missense probably damaging 1.00
R2273:Pcdhb4 UTSW 18 37308926 missense probably damaging 1.00
R3807:Pcdhb4 UTSW 18 37309314 missense probably damaging 0.98
R3815:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3816:Pcdhb4 UTSW 18 37308012 missense probably damaging 1.00
R3974:Pcdhb4 UTSW 18 37308848 missense possibly damaging 0.55
R4558:Pcdhb4 UTSW 18 37309964 missense probably benign
R4606:Pcdhb4 UTSW 18 37308652 missense probably damaging 1.00
R4840:Pcdhb4 UTSW 18 37308399 missense possibly damaging 0.60
R5240:Pcdhb4 UTSW 18 37309926 missense possibly damaging 0.78
R5272:Pcdhb4 UTSW 18 37307766 missense probably benign 0.04
R5586:Pcdhb4 UTSW 18 37308981 missense probably damaging 1.00
R5683:Pcdhb4 UTSW 18 37308989 missense probably benign 0.45
R5917:Pcdhb4 UTSW 18 37309566 missense probably damaging 1.00
R6110:Pcdhb4 UTSW 18 37308429 missense possibly damaging 0.80
R6383:Pcdhb4 UTSW 18 37308021 missense probably damaging 1.00
R6877:Pcdhb4 UTSW 18 37309572 missense probably damaging 1.00
R7036:Pcdhb4 UTSW 18 37308782 missense possibly damaging 0.95
R7204:Pcdhb4 UTSW 18 37309239 missense probably damaging 1.00
R7271:Pcdhb4 UTSW 18 37308169 missense possibly damaging 0.89
R7436:Pcdhb4 UTSW 18 37309275 missense probably damaging 1.00
R7444:Pcdhb4 UTSW 18 37309452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCCTCACCGCTCTGGATG -3'
(R):5'- GGGGCGTTATCATTCACATCC -3'

Sequencing Primer
(F):5'- CTGGGATGACCACAGTTCATATTG -3'
(R):5'- GGGCGTTATCATTCACATCCAACAC -3'
Posted On2015-09-25