Incidental Mutation 'R4618:Tacc2'
ID345099
Institutional Source Beutler Lab
Gene Symbol Tacc2
Ensembl Gene ENSMUSG00000030852
Gene Nametransforming, acidic coiled-coil containing protein 2
Synonyms
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4618 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location130577438-130764785 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130626216 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1563 (T1563S)
Ref Sequence ENSEMBL: ENSMUSP00000149733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059145] [ENSMUST00000084513] [ENSMUST00000124096] [ENSMUST00000207789] [ENSMUST00000207918] [ENSMUST00000208722] [ENSMUST00000215492]
Predicted Effect probably benign
Transcript: ENSMUST00000059145
SMART Domains Protein: ENSMUSP00000061242
Gene: ENSMUSG00000030852

DomainStartEndE-ValueType
low complexity region 87 102 N/A INTRINSIC
low complexity region 147 173 N/A INTRINSIC
internal_repeat_1 181 291 2.03e-5 PROSPERO
low complexity region 345 356 N/A INTRINSIC
internal_repeat_1 483 566 2.03e-5 PROSPERO
low complexity region 571 586 N/A INTRINSIC
low complexity region 603 614 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
coiled coil region 873 900 N/A INTRINSIC
Pfam:TACC 939 1145 4e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084513
AA Change: T1544S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081561
Gene: ENSMUSG00000030852
AA Change: T1544S

DomainStartEndE-ValueType
internal_repeat_1 19 346 3.83e-6 PROSPERO
low complexity region 398 410 N/A INTRINSIC
low complexity region 413 431 N/A INTRINSIC
internal_repeat_1 778 1068 3.83e-6 PROSPERO
low complexity region 1397 1415 N/A INTRINSIC
low complexity region 1723 1739 N/A INTRINSIC
low complexity region 1794 1809 N/A INTRINSIC
low complexity region 1854 1880 N/A INTRINSIC
low complexity region 2052 2063 N/A INTRINSIC
low complexity region 2278 2293 N/A INTRINSIC
low complexity region 2310 2321 N/A INTRINSIC
low complexity region 2355 2369 N/A INTRINSIC
coiled coil region 2606 2633 N/A INTRINSIC
Pfam:TACC 2673 2873 6.1e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207789
Predicted Effect probably benign
Transcript: ENSMUST00000207918
AA Change: T1544S

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207999
Predicted Effect probably benign
Transcript: ENSMUST00000208722
Predicted Effect probably benign
Transcript: ENSMUST00000215492
AA Change: T1563S

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: This gene encodes a member of the transforming, acidic coiled-coil (TACC) family of proteins. Members of this family are centrosomal proteins that interact with microtubules and tubulin. TACC proteins are thought to be involved in centrosome/mitotic spindle dynamics and gene regulation. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile and do not display any increase in tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkd2l1 C A 19: 44,154,134 A490S probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Tacc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Tacc2 APN 7 130759168 missense probably damaging 1.00
IGL01396:Tacc2 APN 7 130759189 missense probably damaging 0.98
IGL01621:Tacc2 APN 7 130729768 missense probably damaging 0.99
IGL02000:Tacc2 APN 7 130729168 unclassified probably null
IGL02075:Tacc2 APN 7 130728852 missense probably benign 0.03
IGL02201:Tacc2 APN 7 130626212 missense possibly damaging 0.84
IGL02205:Tacc2 APN 7 130626682 missense probably damaging 1.00
IGL02399:Tacc2 APN 7 130623399 missense probably benign 0.15
IGL02456:Tacc2 APN 7 130626261 missense probably benign 0.35
IGL02559:Tacc2 APN 7 130759267 missense probably damaging 1.00
IGL02734:Tacc2 APN 7 130626099 missense probably damaging 0.98
IGL02800:Tacc2 APN 7 130624079 missense probably benign 0.40
IGL02938:Tacc2 APN 7 130728941 missense probably damaging 1.00
IGL03031:Tacc2 APN 7 130623855 missense possibly damaging 0.94
IGL03278:Tacc2 APN 7 130733568 critical splice donor site probably null
IGL03283:Tacc2 APN 7 130742266 missense possibly damaging 0.47
IGL03371:Tacc2 APN 7 130626061 missense possibly damaging 0.90
R0002:Tacc2 UTSW 7 130621785 missense probably damaging 0.99
R0119:Tacc2 UTSW 7 130621875 missense probably damaging 0.98
R0244:Tacc2 UTSW 7 130751825 splice site probably benign
R0619:Tacc2 UTSW 7 130716753 missense probably damaging 1.00
R0624:Tacc2 UTSW 7 130577509 missense probably damaging 0.99
R0632:Tacc2 UTSW 7 130625595 nonsense probably null
R1015:Tacc2 UTSW 7 130624065 missense probably benign
R1081:Tacc2 UTSW 7 130728574 missense possibly damaging 0.46
R1086:Tacc2 UTSW 7 130626497 missense possibly damaging 0.94
R1351:Tacc2 UTSW 7 130663003 intron probably benign
R1538:Tacc2 UTSW 7 130625419 missense probably benign 0.03
R1743:Tacc2 UTSW 7 130626598 nonsense probably null
R1771:Tacc2 UTSW 7 130742240 missense probably damaging 1.00
R1876:Tacc2 UTSW 7 130623745 missense probably benign 0.38
R1893:Tacc2 UTSW 7 130625325 missense probably benign 0.01
R1899:Tacc2 UTSW 7 130624202 missense possibly damaging 0.81
R2005:Tacc2 UTSW 7 130731550 missense probably damaging 1.00
R2131:Tacc2 UTSW 7 130621857 missense possibly damaging 0.90
R2338:Tacc2 UTSW 7 130733569 splice site probably null
R2407:Tacc2 UTSW 7 130622040 missense possibly damaging 0.65
R3051:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3052:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3053:Tacc2 UTSW 7 130625496 missense possibly damaging 0.81
R3116:Tacc2 UTSW 7 130759249 missense probably damaging 1.00
R3412:Tacc2 UTSW 7 130734994 missense probably benign 0.02
R3683:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3685:Tacc2 UTSW 7 130625070 missense probably benign 0.40
R3872:Tacc2 UTSW 7 130622422 missense probably benign 0.02
R4063:Tacc2 UTSW 7 130729122 missense probably damaging 0.97
R4410:Tacc2 UTSW 7 130742211 missense possibly damaging 0.80
R4434:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4438:Tacc2 UTSW 7 130623541 missense probably damaging 0.96
R4674:Tacc2 UTSW 7 130624861 missense possibly damaging 0.75
R4742:Tacc2 UTSW 7 130625967 missense probably benign 0.00
R4934:Tacc2 UTSW 7 130728588 missense probably damaging 1.00
R4947:Tacc2 UTSW 7 130625899 missense probably damaging 0.98
R4964:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4966:Tacc2 UTSW 7 130728777 missense probably damaging 1.00
R4967:Tacc2 UTSW 7 130623948 missense probably damaging 0.99
R5052:Tacc2 UTSW 7 130735014 missense probably damaging 1.00
R5276:Tacc2 UTSW 7 130729317 missense probably damaging 1.00
R5330:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5331:Tacc2 UTSW 7 130733528 missense probably damaging 1.00
R5372:Tacc2 UTSW 7 130623260 missense probably benign 0.09
R5556:Tacc2 UTSW 7 130674606 missense probably damaging 0.97
R5645:Tacc2 UTSW 7 130624051 missense possibly damaging 0.80
R5886:Tacc2 UTSW 7 130729120 missense probably benign 0.18
R5996:Tacc2 UTSW 7 130623483 missense probably damaging 0.96
R6074:Tacc2 UTSW 7 130625435 missense possibly damaging 0.92
R6127:Tacc2 UTSW 7 130626115 missense possibly damaging 0.92
R6156:Tacc2 UTSW 7 130625764 missense probably damaging 0.98
R6298:Tacc2 UTSW 7 130626525 missense probably benign 0.26
R6444:Tacc2 UTSW 7 130623412 missense possibly damaging 0.46
R6533:Tacc2 UTSW 7 130622837 missense possibly damaging 0.94
R6724:Tacc2 UTSW 7 130728762 missense probably damaging 1.00
X0010:Tacc2 UTSW 7 130735057 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGGAACTCAGGCTCACTC -3'
(R):5'- GCAGTACTGACAGCAGCTTC -3'

Sequencing Primer
(F):5'- CAGGAATTAACAGTGGGCCTTCC -3'
(R):5'- GTACTGACAGCAGCTTCAATCTG -3'
Posted On2015-09-25