Incidental Mutation 'R0103:Ltb'
ID34510
Institutional Source Beutler Lab
Gene Symbol Ltb
Ensembl Gene ENSMUSG00000024399
Gene Namelymphotoxin B
Synonymslymphotoxin beta, LTbeta, p33, Tnfsf3, Tnfc
MMRRC Submission 038389-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R0103 (G1)
Quality Score224
Status Validated (trace)
Chromosome17
Chromosomal Location35194439-35196320 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 35195040 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025262] [ENSMUST00000025263] [ENSMUST00000167924] [ENSMUST00000173600]
Predicted Effect probably benign
Transcript: ENSMUST00000025262
SMART Domains Protein: ENSMUSP00000025262
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
TNF 154 305 8.76e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025263
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167924
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173510
Predicted Effect probably benign
Transcript: ENSMUST00000173600
SMART Domains Protein: ENSMUSP00000134706
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
TNF 33 184 8.76e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183646
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lymphotoxin beta is a type II membrane protein of the TNF family. It anchors lymphotoxin-alpha to the cell surface through heterotrimer formation. The predominant form on the lymphocyte surface is the lymphotoxin-alpha 1/beta 2 complex (e.g. 1 molecule alpha/2 molecules beta) and this complex is the primary ligand for the lymphotoxin-beta receptor. The minor complex is lymphotoxin-alpha 2/beta 1. LTB is an inducer of the inflammatory response system and involved in normal development of lymphoid tissue. Lymphotoxin-beta isoform b is unable to complex with lymphotoxin-alpha suggesting a function for lymphotoxin-beta which is independent of lympyhotoxin-alpha. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack peripheral lymph nodes, Peyer's patches, splenic germinal centers and follicular dendritic cells. Mutants exhibit lymphocytosis in the circulation and peritoneal cavity with infiltrations of the lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,273,951 R443S probably damaging Het
Anapc1 T C 2: 128,680,452 probably benign Het
Aqr T A 2: 114,149,016 I313F probably damaging Het
Arfgap3 A T 15: 83,322,721 probably benign Het
Asah2 G T 19: 32,018,977 H374N probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Ccdc106 C A 7: 5,057,545 Q35K probably benign Het
Ccm2l G T 2: 153,067,919 E64* probably null Het
Cep85l A T 10: 53,278,174 D776E possibly damaging Het
Cfap52 T A 11: 67,925,125 I611F possibly damaging Het
Cldn22 C T 8: 47,824,554 T9M probably benign Het
Coa7 T C 4: 108,338,141 L89P possibly damaging Het
Cox7a2l A T 17: 83,514,272 Y2N probably damaging Het
Ctns A C 11: 73,185,311 I299M probably damaging Het
Cyp27a1 A C 1: 74,735,915 E301A probably benign Het
Cyp2b13 A T 7: 26,088,710 K421M probably damaging Het
Cyp4f40 G T 17: 32,676,308 C468F probably damaging Het
Cyp4f40 C A 17: 32,676,309 C468* probably null Het
Dcun1d5 G A 9: 7,188,788 C74Y probably damaging Het
Dennd4c A G 4: 86,812,446 Y860C probably benign Het
Dgkz T C 2: 91,934,205 T1028A probably benign Het
Dhx58 T C 11: 100,695,270 T642A probably damaging Het
Dlg4 A G 11: 70,031,193 Y87C probably damaging Het
Dnah6 C T 6: 73,092,172 E2511K probably damaging Het
Entpd5 C A 12: 84,396,943 E9* probably null Het
Fbln2 A C 6: 91,271,550 I1066L probably benign Het
Fhl2 C T 1: 43,153,221 R4H probably benign Het
Frmpd1 T A 4: 45,229,884 I17K probably damaging Het
Gbp7 T A 3: 142,546,538 N627K probably benign Het
Gm20388 A G 8: 122,269,733 probably benign Het
Gnptab A G 10: 88,429,519 Y331C probably damaging Het
Hdac4 T C 1: 91,975,644 E521G possibly damaging Het
Hibadh T A 6: 52,557,877 M173L probably benign Het
Iba57 C T 11: 59,163,613 A27T probably benign Het
Itga1 T C 13: 115,016,254 I211V probably benign Het
Keg1 A T 19: 12,718,916 I155F possibly damaging Het
Krt84 T C 15: 101,530,236 E272G probably damaging Het
Lrp2 C A 2: 69,477,040 V2892L probably benign Het
Masp1 G A 16: 23,458,018 P579L probably damaging Het
Mtor T A 4: 148,533,902 M1724K probably benign Het
Myo3a T G 2: 22,544,322 probably benign Het
Myo9b C T 8: 71,323,849 probably benign Het
Ncor1 G T 11: 62,343,045 Q444K possibly damaging Het
Nek7 A T 1: 138,544,242 C53* probably null Het
Obscn G T 11: 59,062,696 Y4044* probably null Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Pcdh15 A T 10: 74,210,425 D178V probably damaging Het
Pcsk6 T C 7: 65,929,097 probably benign Het
Phxr4 T C 9: 13,431,791 probably benign Het
Pkhd1 T A 1: 20,523,359 D1510V probably benign Het
Pkhd1l1 T C 15: 44,597,141 C4249R probably benign Het
Plxnb2 A G 15: 89,161,769 Y968H possibly damaging Het
Prpf39 T C 12: 65,055,283 V378A possibly damaging Het
Psd2 A G 18: 36,004,717 N455S probably damaging Het
Ptch2 C A 4: 117,109,425 probably benign Het
Rab4b A G 7: 27,174,502 I117T probably benign Het
Rad9b A T 5: 122,331,527 V348E probably damaging Het
Rcor1 T C 12: 111,109,778 probably benign Het
Rhoc A T 3: 104,791,991 E32V possibly damaging Het
Rnf40 T G 7: 127,600,571 V925G probably damaging Het
Rptor G T 11: 119,884,967 R988L probably benign Het
Slc25a32 A T 15: 39,099,897 Y176* probably null Het
Slc7a1 T A 5: 148,352,426 K4* probably null Het
Ss18 A C 18: 14,679,421 Y38D probably damaging Het
Syt4 T A 18: 31,447,220 probably benign Het
Taar4 A T 10: 23,961,406 N305Y probably damaging Het
Taar7b A T 10: 24,000,294 Y119F probably benign Het
Tcaf1 G T 6: 42,686,390 D185E probably benign Het
Tmem138 T C 19: 10,574,952 N62S possibly damaging Het
Tnfaip2 C T 12: 111,445,810 T215M probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Tnfrsf25 C T 4: 152,116,948 P65S possibly damaging Het
Trp53bp1 A T 2: 121,236,759 S495R possibly damaging Het
Trpv3 T C 11: 73,293,979 F597S probably damaging Het
Tsc22d4 A C 5: 137,747,116 M1L possibly damaging Het
Ttc39a A G 4: 109,421,453 probably null Het
Ttn T G 2: 76,761,226 H21033P probably damaging Het
Ugt2a3 A G 5: 87,336,718 V149A possibly damaging Het
Ush2a T G 1: 188,319,070 I251R possibly damaging Het
Vamp4 T C 1: 162,589,539 C114R possibly damaging Het
Wdr33 T C 18: 31,833,335 V135A probably damaging Het
Zc3h13 T A 14: 75,330,468 V1067E probably damaging Het
Zcwpw1 G A 5: 137,810,113 W274* probably null Het
Zfp219 T A 14: 52,006,706 H627L probably damaging Het
Other mutations in Ltb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ltb APN 17 35194666 missense possibly damaging 0.78
IGL01112:Ltb APN 17 35194600 missense probably benign 0.04
IGL02263:Ltb APN 17 35196001 missense probably damaging 1.00
IGL02983:Ltb APN 17 35194670 missense probably benign 0.15
IGL02995:Ltb APN 17 35195372 splice site probably benign
IGL03389:Ltb APN 17 35195068 missense probably benign 0.00
R0103:Ltb UTSW 17 35195040 intron probably benign
R2060:Ltb UTSW 17 35195763 missense probably damaging 0.97
R4718:Ltb UTSW 17 35195337 unclassified probably null
R4823:Ltb UTSW 17 35195230 missense probably benign
R4884:Ltb UTSW 17 35195258 missense probably benign
R5231:Ltb UTSW 17 35195826 missense probably damaging 1.00
R5327:Ltb UTSW 17 35195959 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATAACACTGCACTTGCGTCTC -3'
(R):5'- ACATAGCCAGCACTCTTCGGTCTAC -3'

Sequencing Primer
(F):5'- TCTCTGCCTGCATACATCG -3'
(R):5'- GGTCTACCAGATGCTTACCTATGAG -3'
Posted On2013-05-09