Incidental Mutation 'R4618:Pkd2l1'
ID345144
Institutional Source Beutler Lab
Gene Symbol Pkd2l1
Ensembl Gene ENSMUSG00000037578
Gene Namepolycystic kidney disease 2-like 1
SynonymsPCL, PKD2L, Pkdl, polycystin-L, TRPP3
MMRRC Submission 041884-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R4618 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location44147637-44192442 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 44154134 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 490 (A490S)
Ref Sequence ENSEMBL: ENSMUSP00000045675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042026]
Predicted Effect probably damaging
Transcript: ENSMUST00000042026
AA Change: A490S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045675
Gene: ENSMUSG00000037578
AA Change: A490S

DomainStartEndE-ValueType
transmembrane domain 105 127 N/A INTRINSIC
Pfam:PKD_channel 145 567 1.3e-172 PFAM
Pfam:Ion_trans 335 572 1.8e-30 PFAM
low complexity region 592 598 N/A INTRINSIC
SCOP:d2pvba_ 616 676 2e-4 SMART
PDB:4GIF|A 698 739 1e-17 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161357
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (89/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains multiple transmembrane domains, and cytoplasmic N- and C-termini. The protein may be an integral membrane protein involved in cell-cell/matrix interactions. This protein functions as a calcium-regulated nonselective cation channel. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased chorda tympani nerve response to sour tastants. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432M17Rik A T 3: 121,679,446 K83N unknown Het
Adamtsl3 T A 7: 82,606,520 M1580K probably benign Het
Adprhl1 A G 8: 13,242,250 probably null Het
Akap3 G T 6: 126,866,443 C675F probably benign Het
Asap1 A T 15: 64,152,895 H318Q probably damaging Het
Atf7ip G T 6: 136,565,106 A18S probably damaging Het
Bcl2a1a A C 9: 88,957,304 N85T probably damaging Het
Btnl6 G A 17: 34,514,146 P248S probably damaging Het
C9 A G 15: 6,491,463 D51G probably damaging Het
Ccdc14 T A 16: 34,706,495 C257S probably benign Het
Cd5l A G 3: 87,368,619 T299A probably benign Het
Endou C T 15: 97,713,882 V292M possibly damaging Het
Fbxo36 T C 1: 84,900,028 I137T probably damaging Het
Fcer1a T C 1: 173,222,641 I161V possibly damaging Het
Fsip2 A G 2: 82,987,759 Y4612C probably benign Het
Gcnt2 T A 13: 40,958,194 L353* probably null Het
Ghrhr T C 6: 55,381,754 F172S probably damaging Het
Gins1 T A 2: 150,917,861 probably null Het
Gm16519 T G 17: 70,929,242 L62R probably damaging Het
Gm4758 T A 16: 36,312,590 D76E possibly damaging Het
Gpr20 T C 15: 73,695,736 N268S probably benign Het
Greb1l A G 18: 10,498,965 T283A probably benign Het
Grin2c T A 11: 115,252,747 D729V probably damaging Het
Heatr4 T G 12: 83,978,067 T327P probably damaging Het
Hes2 A C 4: 152,160,388 S105R probably benign Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Ighv1-82 T C 12: 115,952,660 T77A probably benign Het
Itih1 A T 14: 30,929,831 D851E probably benign Het
Klhdc7b A G 15: 89,387,269 T785A probably benign Het
Lmbr1 G T 5: 29,346,865 A74E probably damaging Het
Lonp1 A C 17: 56,622,511 H175Q probably benign Het
Maml2 T C 9: 13,620,075 F195S probably damaging Het
Man2b2 G T 5: 36,817,639 T436K probably benign Het
Man2c1 T C 9: 57,142,155 probably null Het
Mettl11b A T 1: 163,725,028 F10I probably damaging Het
Mrps15 G A 4: 126,047,044 probably benign Het
Mtrf1l C A 10: 5,817,586 V177F probably benign Het
Naxd A T 8: 11,509,489 I213F probably damaging Het
Nbeal1 T A 1: 60,228,731 probably benign Het
Nfatc1 T C 18: 80,697,832 I318V probably damaging Het
Nid2 T A 14: 19,808,010 I1297N probably damaging Het
Nol10 T C 12: 17,348,561 V3A probably damaging Het
Nop14 G T 5: 34,639,218 P765Q probably damaging Het
Noxa1 C T 2: 25,091,749 G114D probably damaging Het
Olfr1100 A G 2: 86,978,274 I174T possibly damaging Het
Olfr1342 A T 4: 118,689,470 probably benign Het
Olfr714 G A 7: 107,074,554 C242Y probably damaging Het
Olfr73 A G 2: 88,034,554 V195A probably benign Het
Opa1 T C 16: 29,587,039 W141R probably damaging Het
Pde4d A T 13: 109,933,877 M7L probably benign Het
Phykpl G A 11: 51,592,229 A188T probably damaging Het
Pkhd1l1 T A 15: 44,539,682 V2260D probably damaging Het
Ptprt T C 2: 161,553,845 E1136G probably damaging Het
Rad21 A T 15: 51,970,024 L353Q probably damaging Het
Rfx4 G T 10: 84,880,896 A425S probably benign Het
Rnf38 A G 4: 44,142,450 S169P probably damaging Het
Samd9l C A 6: 3,376,347 V305F probably damaging Het
Serpini1 A G 3: 75,616,576 K164E probably benign Het
Sirt6 A G 10: 81,626,574 L37P probably damaging Het
Sorbs1 T C 19: 40,373,518 T141A probably damaging Het
Tacc2 A T 7: 130,626,216 T1563S probably benign Het
Tbc1d14 A C 5: 36,530,381 probably benign Het
Tbrg4 G A 11: 6,620,185 probably benign Het
Tox2 T C 2: 163,320,647 L479P probably damaging Het
Tpp1 A T 7: 105,751,706 L38Q probably benign Het
Trhr A G 15: 44,197,641 N186D probably benign Het
Trmt1l C T 1: 151,454,048 Q581* probably null Het
Tsen54 T A 11: 115,815,421 probably benign Het
Tsg101 A G 7: 46,892,509 I138T possibly damaging Het
Usp22 A G 11: 61,161,443 S237P probably damaging Het
Vmn1r209 A G 13: 22,806,449 S24P possibly damaging Het
Vmn2r18 A T 5: 151,584,959 H233Q possibly damaging Het
Vmn2r45 A T 7: 8,483,437 I284N probably benign Het
Vmn2r66 T C 7: 84,995,088 I705V possibly damaging Het
Vsig1 G T X: 140,926,386 A95S probably benign Het
Zdhhc11 T A 13: 73,979,230 M242K probably benign Het
Zfp352 A G 4: 90,225,081 K486R probably benign Het
Other mutations in Pkd2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Pkd2l1 APN 19 44157636 critical splice donor site probably null
IGL00426:Pkd2l1 APN 19 44155605 missense probably benign 0.21
IGL00848:Pkd2l1 APN 19 44192279 utr 5 prime probably benign
IGL01315:Pkd2l1 APN 19 44192196 missense probably benign 0.09
IGL01654:Pkd2l1 APN 19 44154223 missense probably damaging 0.98
IGL01786:Pkd2l1 APN 19 44191442 missense probably damaging 0.96
IGL02174:Pkd2l1 APN 19 44157268 missense probably benign 0.04
IGL02648:Pkd2l1 APN 19 44155536 missense possibly damaging 0.72
R0654:Pkd2l1 UTSW 19 44157631 splice site probably null
R0762:Pkd2l1 UTSW 19 44150470 missense probably benign 0.19
R0981:Pkd2l1 UTSW 19 44154422 critical splice donor site probably null
R1114:Pkd2l1 UTSW 19 44191544 splice site probably benign
R1381:Pkd2l1 UTSW 19 44150463 missense probably benign 0.08
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1467:Pkd2l1 UTSW 19 44154209 missense possibly damaging 0.91
R1754:Pkd2l1 UTSW 19 44155601 nonsense probably null
R2009:Pkd2l1 UTSW 19 44155964 missense probably benign 0.01
R2125:Pkd2l1 UTSW 19 44154500 missense possibly damaging 0.91
R2696:Pkd2l1 UTSW 19 44157269 missense probably benign 0.01
R3001:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3002:Pkd2l1 UTSW 19 44155557 missense possibly damaging 0.81
R3701:Pkd2l1 UTSW 19 44157227 missense probably damaging 0.99
R4179:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4180:Pkd2l1 UTSW 19 44192181 missense probably benign 0.01
R4614:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4616:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4617:Pkd2l1 UTSW 19 44154134 missense probably damaging 0.99
R4762:Pkd2l1 UTSW 19 44155621 missense probably benign 0.09
R4893:Pkd2l1 UTSW 19 44153771 missense probably benign 0.00
R4907:Pkd2l1 UTSW 19 44154142 missense possibly damaging 0.95
R5004:Pkd2l1 UTSW 19 44149577 missense probably benign 0.00
R5380:Pkd2l1 UTSW 19 44157732 missense probably benign 0.33
R5480:Pkd2l1 UTSW 19 44192156 missense probably benign 0.18
R5950:Pkd2l1 UTSW 19 44152090 missense probably benign 0.27
R6248:Pkd2l1 UTSW 19 44157669 missense probably benign 0.00
R6908:Pkd2l1 UTSW 19 44152446 missense probably damaging 1.00
R6925:Pkd2l1 UTSW 19 44191508 missense possibly damaging 0.92
R7021:Pkd2l1 UTSW 19 44154208 missense probably damaging 0.98
R7322:Pkd2l1 UTSW 19 44157690 missense probably benign 0.00
R7378:Pkd2l1 UTSW 19 44153715 missense probably benign 0.05
R7442:Pkd2l1 UTSW 19 44157229 missense probably benign 0.01
X0026:Pkd2l1 UTSW 19 44157182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGAAATTACTCGAGAGCAC -3'
(R):5'- TCTGTCCGTTCCTGGAGTAGTC -3'

Sequencing Primer
(F):5'- GCAGCTGCACTCAGATACCTTTAAG -3'
(R):5'- CCGTTCCTGGAGTAGTCTATGC -3'
Posted On2015-09-25