Incidental Mutation 'R4619:Taf1a'
ID345149
Institutional Source Beutler Lab
Gene Symbol Taf1a
Ensembl Gene ENSMUSG00000072258
Gene NameTATA-box binding protein associated factor, RNA polymerase I, A
SynonymsmTAFI48
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.861) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location183388981-183410198 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 183400598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000094808 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097043] [ENSMUST00000192076]
Predicted Effect probably benign
Transcript: ENSMUST00000097043
SMART Domains Protein: ENSMUSP00000094808
Gene: ENSMUSG00000072258

DomainStartEndE-ValueType
Pfam:TAF1_subA 9 291 1.6e-72 PFAM
Pfam:TAF1_subA 321 446 3e-44 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000192076
AA Change: V142E
SMART Domains Protein: ENSMUSP00000142213
Gene: ENSMUSG00000072258
AA Change: V142E

DomainStartEndE-ValueType
Pfam:TAF1_subA 9 296 8.4e-70 PFAM
Pfam:TAF1_subA 328 360 1.3e-6 PFAM
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the RNA polymerase I complex, Selectivity Factor I (SLI). The encoded protein is a TATA box-binding protein-associated factor that plays a role in the assembly of the RNA polymerase I preinitiation complex. Alternate splicing results in multiple transcript variants encoding multiple isoforms.[provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Taf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1257:Taf1a UTSW 1 183397837 missense possibly damaging 0.71
R2484:Taf1a UTSW 1 183396084 splice site probably benign
R2878:Taf1a UTSW 1 183397835 missense probably damaging 0.97
R3883:Taf1a UTSW 1 183390948 missense possibly damaging 0.53
R5029:Taf1a UTSW 1 183395935 missense possibly damaging 0.70
R5517:Taf1a UTSW 1 183395985 missense probably damaging 1.00
R5799:Taf1a UTSW 1 183395934 missense possibly damaging 0.85
Z1088:Taf1a UTSW 1 183404460 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTATTGGTTGTTTCACATGCC -3'
(R):5'- AGTGTAGTACTGCAGAAGCCC -3'

Sequencing Primer
(F):5'- AACTTGCTTTGTAGACCAGGC -3'
(R):5'- TGCAGAAGCCCTTTGTAAGC -3'
Posted On2015-09-25