Incidental Mutation 'R4619:Mavs'
ID345152
Institutional Source Beutler Lab
Gene Symbol Mavs
Ensembl Gene ENSMUSG00000037523
Gene Namemitochondrial antiviral signaling protein
SynonymsIPS-1, D430028G21Rik
MMRRC Submission 041885-MU
Accession Numbers

MGI: 2444773

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131234063-131248025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 131240450 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 85 (A85S)
Ref Sequence ENSEMBL: ENSMUSP00000105828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041362] [ENSMUST00000110199] [ENSMUST00000130597]
PDB Structure
Crystal structure of TRAF3/Cardif [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000041362
AA Change: A85S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038339
Gene: ENSMUSG00000037523
AA Change: A85S

DomainStartEndE-ValueType
PDB:3J6C|A 1 93 6e-41 PDB
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110199
AA Change: A85S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105828
Gene: ENSMUSG00000037523
AA Change: A85S

DomainStartEndE-ValueType
Pfam:CARD_2 4 92 1.9e-22 PFAM
PDB:4GHU|B 138 158 6e-6 PDB
low complexity region 244 265 N/A INTRINSIC
low complexity region 276 296 N/A INTRINSIC
transmembrane domain 479 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130597
SMART Domains Protein: ENSMUSP00000138401
Gene: ENSMUSG00000037523

DomainStartEndE-ValueType
PDB:3J6C|A 1 52 8e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132694
Meta Mutation Damage Score 0.316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intermediary protein necessary in the virus-triggered beta interferon signaling pathways. It is required for activation of transcription factors which regulate expression of beta interferon and contributes to antiviral immunity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous and heterozygous mice for mutations display defective innate immunity in response to viral infections. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(5) Gene trapped(6)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Mavs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Mavs APN 2 131246716 missense probably damaging 1.00
IGL01520:Mavs APN 2 131245343 missense probably benign 0.38
IGL01909:Mavs APN 2 131245521 missense probably benign 0.43
IGL01941:Mavs APN 2 131246605 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0044:Mavs UTSW 2 131242024 missense probably damaging 1.00
R0045:Mavs UTSW 2 131238831 missense probably damaging 1.00
R0751:Mavs UTSW 2 131246764 missense probably damaging 1.00
R2051:Mavs UTSW 2 131240450 missense possibly damaging 0.94
R2061:Mavs UTSW 2 131240306 splice site probably benign
R2475:Mavs UTSW 2 131240450 missense probably damaging 1.00
R3883:Mavs UTSW 2 131245298 missense probably benign
R4152:Mavs UTSW 2 131246608 missense probably benign 0.22
R4580:Mavs UTSW 2 131240450 missense probably damaging 1.00
R4779:Mavs UTSW 2 131240365 missense probably damaging 1.00
R4928:Mavs UTSW 2 131246743 missense probably benign 0.00
R6092:Mavs UTSW 2 131245598 nonsense probably null
R6211:Mavs UTSW 2 131240391 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTAGAGAAAAGCCTAGGCCACC -3'
(R):5'- ACATGAGGGATGTGGCCATTTG -3'

Sequencing Primer
(F):5'- CCACCTGGCCTAAGGAGG -3'
(R):5'- AGTGGCTCAGCTGGATCTAAATC -3'
Posted On2015-09-25