Incidental Mutation 'R4619:Kif3b'
ID345155
Institutional Source Beutler Lab
Gene Symbol Kif3b
Ensembl Gene ENSMUSG00000027475
Gene Namekinesin family member 3B
Synonyms
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location153291413-153333390 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 153316674 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 132 (R132*)
Ref Sequence ENSEMBL: ENSMUSP00000028977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028977]
Predicted Effect probably null
Transcript: ENSMUST00000028977
AA Change: R132*
SMART Domains Protein: ENSMUSP00000028977
Gene: ENSMUSG00000027475
AA Change: R132*

DomainStartEndE-ValueType
KISc 7 348 6.36e-186 SMART
low complexity region 370 412 N/A INTRINSIC
low complexity region 437 458 N/A INTRINSIC
Blast:KISc 459 535 3e-10 BLAST
low complexity region 537 548 N/A INTRINSIC
Blast:KISc 549 626 4e-27 BLAST
low complexity region 685 697 N/A INTRINSIC
low complexity region 714 735 N/A INTRINSIC
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a heterodimer with kinesin family member 3A to aid in chromosome movement during mitosis and meiosis. The encoded protein is a plus end-directed microtubule motor and can interact with the SMC3 subunit of the cohesin complex. In addition, the encoded protein may be involved in the intracellular movement of membranous organelles. This protein and kinesin family member 3A form the kinesin II subfamily of the kinesin superfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygoous for a targeted null mutation are growth retarded and display neural tube defects, incomplete embryo turning, randomized left-right assymetry, pericardial edema, and die during the midgestational period. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Kif3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kif3b APN 2 153317131 missense probably damaging 0.99
IGL00927:Kif3b APN 2 153316461 missense possibly damaging 0.89
IGL02121:Kif3b APN 2 153317274 missense probably damaging 0.99
IGL02302:Kif3b APN 2 153316948 missense probably damaging 1.00
IGL02306:Kif3b APN 2 153320652 missense probably damaging 1.00
IGL02348:Kif3b APN 2 153316893 missense probably damaging 0.98
IGL03111:Kif3b APN 2 153330068 missense probably benign 0.00
R1463:Kif3b UTSW 2 153330153 makesense probably null
R1474:Kif3b UTSW 2 153320315 missense probably damaging 1.00
R1485:Kif3b UTSW 2 153322931 splice site probably null
R1538:Kif3b UTSW 2 153317462 small deletion probably benign
R1834:Kif3b UTSW 2 153317485 missense probably benign 0.22
R2371:Kif3b UTSW 2 153322823 missense possibly damaging 0.66
R4051:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4208:Kif3b UTSW 2 153323557 missense probably damaging 0.99
R4504:Kif3b UTSW 2 153323644 critical splice donor site probably null
R4806:Kif3b UTSW 2 153320368 missense probably damaging 1.00
R4911:Kif3b UTSW 2 153317292 nonsense probably null
X0026:Kif3b UTSW 2 153316321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACGCCAAGCAGTTTGAGC -3'
(R):5'- GGTTTCCCACATTCATCACATG -3'

Sequencing Primer
(F):5'- AGCTCTATGATGAGACGTTCCGAC -3'
(R):5'- CCACATTCATCACATGCTCTATC -3'
Posted On2015-09-25