Incidental Mutation 'R4619:Sptb'
ID345194
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.616) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 76583807 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 2244 (C2244*)
Ref Sequence ENSEMBL: ENSMUSP00000021458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000075249]
Predicted Effect probably null
Transcript: ENSMUST00000021458
AA Change: C2244*
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: C2244*

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075249
SMART Domains Protein: ENSMUSP00000074729
Gene: ENSMUSG00000052609

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
RhoGEF 97 271 6.67e-51 SMART
PH 297 396 2.48e-9 SMART
coiled coil region 515 552 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
low complexity region 696 710 N/A INTRINSIC
low complexity region 727 737 N/A INTRINSIC
low complexity region 753 766 N/A INTRINSIC
low complexity region 978 993 N/A INTRINSIC
low complexity region 1233 1246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219426
Meta Mutation Damage Score 0.61 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5725:Sptb UTSW 12 76623114 missense probably benign 0.25
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
X0057:Sptb UTSW 12 76630739 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAAGGGTTTTGAGTCATGGTACC -3'
(R):5'- CAAGCAGCAAGGTTATTGGAGC -3'

Sequencing Primer
(F):5'- GAGTCATGGTACCATCTCCAG -3'
(R):5'- CAGCAAGGTTATTGGAGCTGGTTG -3'
Posted On2015-09-25