Incidental Mutation 'R4619:Kcnh3'
ID345199
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99234101 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 646 (V646M)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041415]
Predicted Effect probably damaging
Transcript: ENSMUST00000041415
AA Change: V646M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: V646M

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0427:Kcnh3 UTSW 15 99233299 missense probably benign 0.22
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0538:Kcnh3 UTSW 15 99240958 missense probably benign 0.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4620:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6640:Kcnh3 UTSW 15 99241768 missense probably benign 0.08
R6879:Kcnh3 UTSW 15 99238167 missense probably damaging 1.00
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCGTGCAGACATCGCCATG -3'
(R):5'- ATCACTGGCTCATCTTTGAACTTTG -3'

Sequencing Primer
(F):5'- GACATCGCCATGCACCTG -3'
(R):5'- AACTTTGTCTAGAGCTCTGGC -3'
Posted On2015-09-25