Incidental Mutation 'R4619:Zbtb21'
ID345205
Institutional Source Beutler Lab
Gene Symbol Zbtb21
Ensembl Gene ENSMUSG00000046962
Gene Namezinc finger and BTB domain containing 21
SynonymsZfp295, B430213I24Rik, 5430437K12Rik, Znf295
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R4619 (G1)
Quality Score219
Status Validated
Chromosome16
Chromosomal Location97943357-97962622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97949892 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1092 (T1092A)
Ref Sequence ENSEMBL: ENSMUSP00000109363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052089] [ENSMUST00000063605] [ENSMUST00000113734] [ENSMUST00000231263] [ENSMUST00000231560] [ENSMUST00000232165] [ENSMUST00000232187]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052089
AA Change: T892A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052127
Gene: ENSMUSG00000046962
AA Change: T892A

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 578 598 2.14e2 SMART
ZnF_C2H2 605 628 8.67e-1 SMART
low complexity region 708 728 N/A INTRINSIC
ZnF_C2H2 737 757 2.06e1 SMART
ZnF_C2H2 765 787 4.65e-1 SMART
low complexity region 804 829 N/A INTRINSIC
ZnF_C2H2 871 893 1.79e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063605
AA Change: T1064A

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000068283
Gene: ENSMUSG00000046962
AA Change: T1064A

DomainStartEndE-ValueType
BTB 30 126 5.14e-18 SMART
low complexity region 433 442 N/A INTRINSIC
low complexity region 452 465 N/A INTRINSIC
ZnF_C2H2 549 572 8.09e-1 SMART
ZnF_C2H2 578 601 2.63e0 SMART
ZnF_C2H2 673 695 3.58e-2 SMART
ZnF_C2H2 750 770 2.14e2 SMART
ZnF_C2H2 777 800 8.67e-1 SMART
low complexity region 880 900 N/A INTRINSIC
ZnF_C2H2 909 929 2.06e1 SMART
ZnF_C2H2 937 959 4.65e-1 SMART
low complexity region 976 1001 N/A INTRINSIC
ZnF_C2H2 1043 1065 1.79e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113734
AA Change: T1092A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109363
Gene: ENSMUSG00000046962
AA Change: T1092A

DomainStartEndE-ValueType
BTB 58 154 5.14e-18 SMART
low complexity region 461 470 N/A INTRINSIC
low complexity region 480 493 N/A INTRINSIC
ZnF_C2H2 577 600 8.09e-1 SMART
ZnF_C2H2 606 629 2.63e0 SMART
ZnF_C2H2 701 723 3.58e-2 SMART
ZnF_C2H2 778 798 2.14e2 SMART
ZnF_C2H2 805 828 8.67e-1 SMART
low complexity region 908 928 N/A INTRINSIC
ZnF_C2H2 937 957 2.06e1 SMART
ZnF_C2H2 965 987 4.65e-1 SMART
low complexity region 1004 1029 N/A INTRINSIC
ZnF_C2H2 1071 1093 1.79e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231256
Predicted Effect probably benign
Transcript: ENSMUST00000231263
Predicted Effect probably benign
Transcript: ENSMUST00000231560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232010
Predicted Effect probably benign
Transcript: ENSMUST00000232165
Predicted Effect probably benign
Transcript: ENSMUST00000232187
AA Change: T378A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.046 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Zbtb21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Zbtb21 APN 16 97952320 missense probably benign 0.03
IGL00921:Zbtb21 APN 16 97952022 missense probably damaging 1.00
IGL01825:Zbtb21 APN 16 97952689 missense possibly damaging 0.63
IGL02310:Zbtb21 APN 16 97951790 missense possibly damaging 0.89
IGL03126:Zbtb21 APN 16 97951745 missense probably damaging 1.00
IGL03332:Zbtb21 APN 16 97952333 missense possibly damaging 0.94
R0165:Zbtb21 UTSW 16 97951404 missense probably damaging 1.00
R0184:Zbtb21 UTSW 16 97950513 missense probably damaging 1.00
R0267:Zbtb21 UTSW 16 97952100 missense probably damaging 1.00
R0734:Zbtb21 UTSW 16 97952627 missense probably damaging 1.00
R1546:Zbtb21 UTSW 16 97952027 missense probably damaging 0.97
R1565:Zbtb21 UTSW 16 97952427 missense probably benign 0.00
R1778:Zbtb21 UTSW 16 97950585 missense probably benign 0.02
R2049:Zbtb21 UTSW 16 97950155 missense probably damaging 1.00
R4086:Zbtb21 UTSW 16 97952763 missense probably damaging 1.00
R4620:Zbtb21 UTSW 16 97949892 missense possibly damaging 0.95
R4754:Zbtb21 UTSW 16 97951266 missense probably damaging 1.00
R4785:Zbtb21 UTSW 16 97950455 missense possibly damaging 0.60
R5466:Zbtb21 UTSW 16 97950498 missense possibly damaging 0.66
R5989:Zbtb21 UTSW 16 97951499 missense probably damaging 1.00
R6374:Zbtb21 UTSW 16 97950368 missense probably damaging 0.98
R6469:Zbtb21 UTSW 16 97956772 missense probably benign 0.01
R6732:Zbtb21 UTSW 16 97951082 missense probably damaging 0.97
R6830:Zbtb21 UTSW 16 97951961 missense probably damaging 1.00
X0022:Zbtb21 UTSW 16 97952075 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGAAAGCTGTGAGGTCATTTC -3'
(R):5'- ACCCTTGCCCAAGATTCAG -3'

Sequencing Primer
(F):5'- AAAGCTGTGAGGTCATTTCTAGCC -3'
(R):5'- AAGATTCAGCCCCTGGAGC -3'
Posted On2015-09-25