Incidental Mutation 'R4619:Tiam2'
ID345206
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.399) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3518342 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1588 (I1588F)
Ref Sequence ENSEMBL: ENSMUSP00000125842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041003] [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405]
Predicted Effect probably benign
Transcript: ENSMUST00000041003
SMART Domains Protein: ENSMUSP00000035291
Gene: ENSMUSG00000036983

DomainStartEndE-ValueType
rADc 43 234 5.56e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000072156
AA Change: I1588F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: I1588F

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169838
AA Change: I1588F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: I1588F

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226997
Predicted Effect probably benign
Transcript: ENSMUST00000227405
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGGCCTCAGAACATCCTC -3'
(R):5'- CTTGAGCAAAGTTCCTCTGCC -3'

Sequencing Primer
(F):5'- ACATCCTCCAGCAGCGAGTG -3'
(R):5'- CTTTCCGTTTAATGGGGCAAAAATGG -3'
Posted On2015-09-25