Incidental Mutation 'R4619:Birc6'
ID345209
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Namebaculoviral IAP repeat-containing 6
SynonymsD630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4619 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location74528295-74703356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 74640150 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 2955 (T2955P)
Ref Sequence ENSEMBL: ENSMUSP00000138693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182597] [ENSMUST00000182944] [ENSMUST00000183224]
Predicted Effect probably benign
Transcript: ENSMUST00000180037
AA Change: T2961P

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: T2961P

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182133
AA Change: T2955P

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: T2955P

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect probably benign
Transcript: ENSMUST00000182597
AA Change: T2970P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: T2970P

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182944
AA Change: T2957P

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: T2957P

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183224
AA Change: T2941P

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: T2941P

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Ppp1r3c A T 19: 36,734,343 V9E possibly damaging Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74573563 splice site probably benign
IGL00542:Birc6 APN 17 74623771 unclassified probably null
IGL00659:Birc6 APN 17 74660653 missense probably damaging 1.00
IGL00710:Birc6 APN 17 74609089 missense probably benign 0.37
IGL00806:Birc6 APN 17 74611529 missense possibly damaging 0.85
IGL00848:Birc6 APN 17 74696393 nonsense probably null
IGL01071:Birc6 APN 17 74566132 missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74631701 missense probably damaging 1.00
IGL01121:Birc6 APN 17 74631038 missense probably benign 0.08
IGL01132:Birc6 APN 17 74603060 missense probably damaging 1.00
IGL01323:Birc6 APN 17 74622925 missense probably damaging 1.00
IGL01444:Birc6 APN 17 74631687 missense probably damaging 1.00
IGL01511:Birc6 APN 17 74627003 nonsense probably null
IGL01576:Birc6 APN 17 74677370 missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74648197 missense probably benign 0.08
IGL01649:Birc6 APN 17 74604546 missense probably benign 0.03
IGL01657:Birc6 APN 17 74660611 missense probably damaging 1.00
IGL01739:Birc6 APN 17 74659221 missense probably benign
IGL01756:Birc6 APN 17 74640208 missense probably benign 0.00
IGL01807:Birc6 APN 17 74631037 missense probably benign
IGL01885:Birc6 APN 17 74604516 missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74638358 missense probably damaging 1.00
IGL01915:Birc6 APN 17 74631720 missense probably benign 0.34
IGL01998:Birc6 APN 17 74579885 missense probably benign 0.06
IGL02084:Birc6 APN 17 74608282 missense probably benign 0.45
IGL02086:Birc6 APN 17 74639827 missense probably damaging 1.00
IGL02161:Birc6 APN 17 74548837 missense probably damaging 0.99
IGL02195:Birc6 APN 17 74697381
IGL02283:Birc6 APN 17 74599940 missense probably benign
IGL02476:Birc6 APN 17 74696391 missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74652059 unclassified probably benign
IGL02547:Birc6 APN 17 74579645 missense probably benign 0.21
IGL02678:Birc6 APN 17 74649903 missense probably damaging 1.00
IGL02713:Birc6 APN 17 74579324 missense probably benign
IGL02851:Birc6 APN 17 74609189 missense probably damaging 1.00
IGL02875:Birc6 APN 17 74589718 missense probably damaging 1.00
IGL02985:Birc6 APN 17 74640190 missense probably benign 0.00
IGL03004:Birc6 APN 17 74612185 missense probably benign 0.10
IGL03053:Birc6 APN 17 74565972 missense probably damaging 1.00
IGL03085:Birc6 APN 17 74596950 missense probably damaging 0.97
IGL03109:Birc6 APN 17 74579334 missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74598999 missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74659231
IGL03221:Birc6 APN 17 74627007 missense probably benign 0.00
IGL03230:Birc6 APN 17 74611070 missense probably damaging 1.00
IGL03294:Birc6 APN 17 74649886 missense probably benign 0.02
IGL03399:Birc6 APN 17 74594373 missense probably benign 0.01
Badlands UTSW 17 74603036 missense probably damaging 1.00
Badlands2 UTSW 17 74692332 missense probably damaging 1.00
bottomlands UTSW 17 74609659 missense
E0370:Birc6 UTSW 17 74677357 missense probably damaging 1.00
R0081:Birc6 UTSW 17 74643441 missense probably benign 0.01
R0086:Birc6 UTSW 17 74593166 missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74638376 missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74623746 splice site probably benign
R0129:Birc6 UTSW 17 74528760 missense probably benign 0.05
R0196:Birc6 UTSW 17 74580287 missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74609327 missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74662832 splice site probably benign
R0295:Birc6 UTSW 17 74613362 intron probably benign
R0386:Birc6 UTSW 17 74599340 missense probably damaging 0.99
R0423:Birc6 UTSW 17 74696297 missense probably damaging 1.00
R0449:Birc6 UTSW 17 74692295 missense probably damaging 1.00
R0453:Birc6 UTSW 17 74649754 missense probably damaging 1.00
R0457:Birc6 UTSW 17 74652028 missense probably benign
R0457:Birc6 UTSW 17 74662625 missense probably damaging 1.00
R0564:Birc6 UTSW 17 74625243 splice site probably benign
R0575:Birc6 UTSW 17 74689237 missense probably damaging 1.00
R0582:Birc6 UTSW 17 74643337 missense probably damaging 1.00
R0624:Birc6 UTSW 17 74580349 missense probably benign 0.20
R0973:Birc6 UTSW 17 74565861 missense probably damaging 0.99
R1061:Birc6 UTSW 17 74689312 missense probably damaging 1.00
R1378:Birc6 UTSW 17 74660455 missense probably damaging 1.00
R1402:Birc6 UTSW 17 74697533 splice site probably benign
R1436:Birc6 UTSW 17 74652705 missense probably damaging 1.00
R1456:Birc6 UTSW 17 74609290 missense probably benign 0.35
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1474:Birc6 UTSW 17 74579678 missense probably damaging 0.98
R1479:Birc6 UTSW 17 74634853 missense probably damaging 1.00
R1486:Birc6 UTSW 17 74639820 missense probably damaging 1.00
R1499:Birc6 UTSW 17 74612319 missense probably damaging 1.00
R1515:Birc6 UTSW 17 74528636 nonsense probably null
R1549:Birc6 UTSW 17 74662742 missense probably damaging 1.00
R1559:Birc6 UTSW 17 74692237 missense probably damaging 1.00
R1573:Birc6 UTSW 17 74660690 splice site probably benign
R1615:Birc6 UTSW 17 74609409 intron probably null
R1621:Birc6 UTSW 17 74670250 missense probably benign
R1680:Birc6 UTSW 17 74548746 missense probably benign 0.01
R1743:Birc6 UTSW 17 74579756 missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74640013 missense probably damaging 1.00
R1775:Birc6 UTSW 17 74612286 missense probably damaging 1.00
R1818:Birc6 UTSW 17 74649849 missense probably damaging 1.00
R1836:Birc6 UTSW 17 74614390 missense probably benign 0.41
R1931:Birc6 UTSW 17 74565982 missense probably damaging 0.99
R1939:Birc6 UTSW 17 74670337 missense probably damaging 1.00
R1964:Birc6 UTSW 17 74634885 missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74598062 missense probably benign 0.01
R2000:Birc6 UTSW 17 74604619 missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74609659 missense probably damaging 1.00
R2090:Birc6 UTSW 17 74662796 missense probably benign
R2130:Birc6 UTSW 17 74659154 splice site probably benign
R2144:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74635795 missense probably benign 0.02
R2180:Birc6 UTSW 17 74612151 missense probably benign 0.03
R2271:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2272:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2416:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2421:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2422:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2513:Birc6 UTSW 17 74647729 missense probably damaging 0.97
R2912:Birc6 UTSW 17 74692206 missense probably damaging 1.00
R3024:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74618429 splice site probably benign
R3772:Birc6 UTSW 17 74618429 splice site probably benign
R3829:Birc6 UTSW 17 74655178 missense probably damaging 1.00
R3913:Birc6 UTSW 17 74573613 nonsense probably null
R3915:Birc6 UTSW 17 74579608 missense probably benign 0.12
R3921:Birc6 UTSW 17 74627019 missense probably damaging 0.98
R3928:Birc6 UTSW 17 74611175 missense possibly damaging 0.91
R3928:Birc6 UTSW 17 74638409 missense probably damaging 1.00
R4111:Birc6 UTSW 17 74566015 missense probably damaging 1.00
R4155:Birc6 UTSW 17 74596939 missense probably benign 0.00
R4163:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R4226:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4227:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4358:Birc6 UTSW 17 74619668 intron probably null
R4524:Birc6 UTSW 17 74641777 missense probably damaging 1.00
R4605:Birc6 UTSW 17 74639934 missense probably damaging 1.00
R4620:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4762:Birc6 UTSW 17 74629489 missense probably damaging 1.00
R4814:Birc6 UTSW 17 74649672 missense probably damaging 1.00
R4849:Birc6 UTSW 17 74647388 missense probably damaging 0.99
R4869:Birc6 UTSW 17 74586012 missense probably benign 0.05
R4912:Birc6 UTSW 17 74565905 missense probably damaging 1.00
R4921:Birc6 UTSW 17 74650099 missense probably damaging 1.00
R4942:Birc6 UTSW 17 74623050 missense probably damaging 1.00
R4954:Birc6 UTSW 17 74612031 missense probably damaging 1.00
R4992:Birc6 UTSW 17 74689256 missense probably benign 0.44
R4994:Birc6 UTSW 17 74594324 intron probably benign
R5018:Birc6 UTSW 17 74640059 missense probably damaging 1.00
R5022:Birc6 UTSW 17 74692332 missense probably damaging 1.00
R5054:Birc6 UTSW 17 74655325 missense probably damaging 1.00
R5068:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5069:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5070:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5196:Birc6 UTSW 17 74606141 splice site probably benign
R5209:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5212:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5216:Birc6 UTSW 17 74613470 missense probably damaging 1.00
R5279:Birc6 UTSW 17 74650047 missense probably damaging 0.98
R5286:Birc6 UTSW 17 74670247 missense probably damaging 1.00
R5399:Birc6 UTSW 17 74604578 missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74641782 missense possibly damaging 0.86
R5482:Birc6 UTSW 17 74662690 missense probably damaging 1.00
R5492:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5504:Birc6 UTSW 17 74655213 missense probably damaging 1.00
R5519:Birc6 UTSW 17 74580178 missense probably benign
R5544:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5608:Birc6 UTSW 17 74613544 missense probably damaging 0.99
R5623:Birc6 UTSW 17 74528656 missense probably damaging 0.99
R5701:Birc6 UTSW 17 74697425 missense possibly damaging 0.59
R5707:Birc6 UTSW 17 74696404 missense probably damaging 1.00
R5715:Birc6 UTSW 17 74631620 missense probably damaging 1.00
R5734:Birc6 UTSW 17 74618424 splice site probably benign
R5792:Birc6 UTSW 17 74631053 missense probably benign 0.05
R5809:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5810:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5813:Birc6 UTSW 17 74646502 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599237 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599238 missense probably damaging 0.98
R5960:Birc6 UTSW 17 74528765 missense probably damaging 0.97
R5961:Birc6 UTSW 17 74646601 missense probably damaging 1.00
R5967:Birc6 UTSW 17 74660439 missense probably damaging 0.99
R5970:Birc6 UTSW 17 74618502 missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74603036 missense probably damaging 1.00
R5982:Birc6 UTSW 17 74648158 missense probably benign
R6023:Birc6 UTSW 17 74654377 missense probably benign 0.24
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6243:Birc6 UTSW 17 74609387 missense probably damaging 0.96
R6294:Birc6 UTSW 17 74689257 missense probably benign 0.00
R6327:Birc6 UTSW 17 74662779 missense probably damaging 1.00
R6501:Birc6 UTSW 17 74579281 missense probably damaging 1.00
R6810:Birc6 UTSW 17 74612220 missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74580382 missense possibly damaging 0.82
R6822:Birc6 UTSW 17 74598044 missense probably damaging 1.00
R6835:Birc6 UTSW 17 74642504 missense probably damaging 1.00
R6945:Birc6 UTSW 17 74579531 missense probably benign 0.04
R6957:Birc6 UTSW 17 74579491 missense probably benign
R6989:Birc6 UTSW 17 74630989 missense probably benign 0.18
Z1088:Birc6 UTSW 17 74611542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCTCCGACAAAGTCATGTCTAG -3'
(R):5'- GGCACTGCTATTACACAGGC -3'

Sequencing Primer
(F):5'- CTCCGACAAAGTCATGTCTAGAAGTG -3'
(R):5'- ACTGCTATTACACAGGCCTAGGG -3'
Posted On2015-09-25