Incidental Mutation 'R4619:Ppp1r3c'
ID345212
Institutional Source Beutler Lab
Gene Symbol Ppp1r3c
Ensembl Gene ENSMUSG00000067279
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3C
Synonymsprotein targeting to glicogen, Ppp1r5, PTG
MMRRC Submission 041885-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4619 (G1)
Quality Score164
Status Validated
Chromosome19
Chromosomal Location36731737-36736653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36734343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000084578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087321]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087321
AA Change: V9E

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084578
Gene: ENSMUSG00000067279
AA Change: V9E

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
Pfam:CBM_21 151 257 5.5e-38 PFAM
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a carbohydrate binding protein that is a subunit of the protein phosphatase 1 (PP1) complex. PP1 catalyzes reversible protein phosphorylation, which is important in a wide range of cellular activities. The encoded protein affects glycogen biosynthesis by activating glycogen synthase and limiting glycogen breakdown by reducing glycogen phosphorylase activity. DNA hypermethylation of this gene has been found in colorectal cancer patients. The encoded protein also interacts with the laforin protein, which is a protein tyrosine phosphatase implicated in Lafora disease. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice are embyronic lethal. Heterozygotes have reduced glycogen stores, attenuated glycogen synthesis, glucose intolerance, hyperinsulinemia and insulin resistance. Mice homozygous for a different knock-out allele exhibit normal lifespan with enhanced whole body insulin sensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 138,069,759 V1570I probably damaging Het
Alx4 A G 2: 93,642,761 R35G probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
Atp8b3 G A 10: 80,526,024 T731I possibly damaging Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Cdh15 G A 8: 122,860,873 D179N probably damaging Het
Cntnap5c G T 17: 58,410,268 V1282L probably benign Het
Crocc2 G A 1: 93,213,650 R1175H probably benign Het
Dbh A G 2: 27,174,824 D349G probably damaging Het
Dync1h1 A G 12: 110,638,844 I2372V probably benign Het
Fam196a A G 7: 134,918,541 Y87H probably damaging Het
Fer1l4 A T 2: 156,047,087 W389R probably damaging Het
Fndc1 T C 17: 7,765,204 T1297A unknown Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
Gm5591 G A 7: 38,520,648 S267L probably benign Het
Gzmk A G 13: 113,173,123 V92A probably damaging Het
Hspg2 C T 4: 137,546,573 R2680W probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kcnk7 A C 19: 5,706,435 I230L probably benign Het
Kif3b C T 2: 153,316,674 R132* probably null Het
Klra5 T C 6: 129,908,813 S128G probably benign Het
Krba1 C T 6: 48,406,348 R4* probably null Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Lss A G 10: 76,536,255 D148G probably benign Het
Mavs G T 2: 131,240,450 A85S probably damaging Het
Mipep T C 14: 60,903,416 C566R probably damaging Het
Myocd T A 11: 65,178,428 probably benign Het
Ndufa9 C T 6: 126,827,535 probably null Het
Nolc1 G A 19: 46,083,520 G583D probably damaging Het
Nucb2 T C 7: 116,527,824 probably null Het
Olfr1357 T C 10: 78,612,575 D22G probably benign Het
Olfr487 A T 7: 108,212,094 I145N possibly damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Pank4 C A 4: 154,976,619 D508E probably benign Het
Phb T A 11: 95,671,590 probably benign Het
Pign T A 1: 105,521,990 probably benign Het
Plec T C 15: 76,192,182 K349E probably benign Het
Rap1gap T A 4: 137,716,111 V130D probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Serpina3f T C 12: 104,217,290 I137T possibly damaging Het
Slc46a3 T A 5: 147,886,730 K101* probably null Het
Snph G A 2: 151,594,514 Q96* probably null Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Ssc5d A T 7: 4,929,525 H396L probably damaging Het
Sulf1 A C 1: 12,786,652 R42S probably damaging Het
Taf1a T A 1: 183,400,598 probably benign Het
Thoc5 T A 11: 4,926,218 M609K probably damaging Het
Tiam2 A T 17: 3,518,342 I1588F probably damaging Het
Tmcc1 C T 6: 116,043,286 V402I probably damaging Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trbv31 T C 6: 41,557,967 I21V probably benign Het
Vmn1r74 A T 7: 11,847,471 T233S possibly damaging Het
Vmn1r74 G C 7: 11,847,476 Q234H probably damaging Het
Vsx1 A T 2: 150,688,609 S118T probably benign Het
Wnt9b G A 11: 103,731,123 T236I probably benign Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zc3hc1 G A 6: 30,387,524 T52I probably benign Het
Zfp558 T A 9: 18,456,281 N404Y possibly damaging Het
Zfp735 A T 11: 73,711,205 D325V probably damaging Het
Zhx3 A T 2: 160,781,959 M96K probably damaging Het
Other mutations in Ppp1r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Ppp1r3c APN 19 36734103 missense probably damaging 1.00
IGL00486:Ppp1r3c APN 19 36733924 missense probably damaging 1.00
IGL01865:Ppp1r3c APN 19 36734178 missense probably benign 0.00
IGL02896:Ppp1r3c APN 19 36733465 missense probably benign 0.26
R0110:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0450:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R0456:Ppp1r3c UTSW 19 36733891 nonsense probably null
R0469:Ppp1r3c UTSW 19 36734217 missense possibly damaging 0.66
R1539:Ppp1r3c UTSW 19 36733961 missense probably benign
R1859:Ppp1r3c UTSW 19 36733611 missense probably damaging 1.00
R2228:Ppp1r3c UTSW 19 36733698 missense probably benign
R2229:Ppp1r3c UTSW 19 36733698 missense probably benign
R4534:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4535:Ppp1r3c UTSW 19 36734122 missense probably damaging 1.00
R4630:Ppp1r3c UTSW 19 36733515 missense probably benign 0.02
R6015:Ppp1r3c UTSW 19 36733806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACTCTGCGATTTGGC -3'
(R):5'- AGGCAGTTTACACATGGGC -3'

Sequencing Primer
(F):5'- GGCTTCCTGCTTGACACTGAG -3'
(R):5'- TGCACTGGAGTACTAGTG -3'
Posted On2015-09-25