Incidental Mutation 'R4620:Postn'
ID345218
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 54376993 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 627 (D627A)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: D627A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: D627A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: D627A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: D627A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: D627A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: D627A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: D627A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: D627A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
R7430:Postn UTSW 3 54370202 missense probably damaging 1.00
R7497:Postn UTSW 3 54362670 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACCCGGAGTCACTAATATCCTG -3'
(R):5'- ATCTACGGAGATAAACACTCAGTGAG -3'

Sequencing Primer
(F):5'- CGGAGTCACTAATATCCTGAAGAC -3'
(R):5'- CGGAGATAAACACTCAGTGAGTATGG -3'
Posted On2015-09-25