Incidental Mutation 'R4620:Megf8'
ID345235
Institutional Source Beutler Lab
Gene Symbol Megf8
Ensembl Gene ENSMUSG00000045039
Gene Namemultiple EGF-like-domains 8
SynonymsEgfl4, b2b1702Clo, m687Ddg, b2b288Clo
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25317164-25365917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25355098 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 1880 (A1880T)
Ref Sequence ENSEMBL: ENSMUSP00000122192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000128119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000128119
AA Change: A1880T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122192
Gene: ENSMUSG00000045039
AA Change: A1880T

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CUB 33 140 1.24e-15 SMART
EGF 141 170 4.26e0 SMART
EGF 173 203 2.43e1 SMART
Pfam:Kelch_4 227 277 1.3e-11 PFAM
Pfam:Kelch_3 240 287 1.6e-7 PFAM
low complexity region 320 341 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 728 738 N/A INTRINSIC
PSI 847 899 1.37e0 SMART
low complexity region 932 938 N/A INTRINSIC
PSI 949 991 2.11e-2 SMART
PSI 1005 1073 7.82e-1 SMART
EGF_CA 1074 1115 2.62e-9 SMART
EGF 1117 1160 5.4e-2 SMART
EGF_like 1163 1208 4e-1 SMART
EGF_Lam 1211 1259 1.03e-7 SMART
Blast:CUB 1263 1401 1e-30 BLAST
EGF_like 1406 1445 3.29e1 SMART
Pfam:Kelch_4 1509 1564 6.5e-12 PFAM
Pfam:Kelch_3 1520 1574 1.2e-10 PFAM
PSI 1868 1923 2.75e-1 SMART
PSI 2004 2062 1.6e0 SMART
PSI 2064 2121 1.68e-5 SMART
EGF 2125 2164 1.08e-1 SMART
EGF 2166 2194 4.26e0 SMART
EGF 2204 2244 2.2e1 SMART
EGF_like 2248 2321 6.37e-1 SMART
low complexity region 2493 2504 N/A INTRINSIC
low complexity region 2530 2541 N/A INTRINSIC
transmembrane domain 2592 2614 N/A INTRINSIC
low complexity region 2649 2668 N/A INTRINSIC
low complexity region 2674 2702 N/A INTRINSIC
low complexity region 2759 2774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153077
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein of unknown function that contains several EGF-like domains, Kelch repeats, and PSI domains. Defects in this gene are a cause of Carpenter syndrome 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit varying degrees of heterotaxia and congenital heart defects. Mice homozygous for another ENU-induced mutation exhibit abnormal development and patterning of the peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Senp3 T A 11: 69,677,118 Y432F probably benign Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Megf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Megf8 APN 7 25343684 missense possibly damaging 0.87
IGL00696:Megf8 APN 7 25342392 missense probably benign
IGL01021:Megf8 APN 7 25338374 missense probably benign 0.39
IGL01290:Megf8 APN 7 25349658 nonsense probably null
IGL01392:Megf8 APN 7 25363749 missense probably benign 0.03
IGL01410:Megf8 APN 7 25359871 missense probably benign 0.01
IGL01634:Megf8 APN 7 25358781 splice site probably benign
IGL01648:Megf8 APN 7 25327572 missense probably damaging 1.00
IGL01930:Megf8 APN 7 25334861 missense probably damaging 1.00
IGL01954:Megf8 APN 7 25349014 missense possibly damaging 0.94
IGL02150:Megf8 APN 7 25346417 splice site probably null
IGL02192:Megf8 APN 7 25353860 missense probably damaging 1.00
IGL02250:Megf8 APN 7 25342575 missense probably benign 0.02
IGL02301:Megf8 APN 7 25337900 missense probably damaging 0.96
IGL02317:Megf8 APN 7 25363788 missense probably damaging 1.00
IGL02324:Megf8 APN 7 25340448 missense probably benign 0.10
IGL02503:Megf8 APN 7 25363563 missense possibly damaging 0.70
IGL02583:Megf8 APN 7 25355793 missense probably benign
IGL02636:Megf8 APN 7 25358432 missense probably damaging 0.99
IGL02704:Megf8 APN 7 25359782 missense probably damaging 0.97
IGL02898:Megf8 APN 7 25346508 missense possibly damaging 0.79
IGL03082:Megf8 APN 7 25330236 missense probably benign
IGL03182:Megf8 APN 7 25347348 missense possibly damaging 0.92
PIT4810001:Megf8 UTSW 7 25342285 missense probably damaging 1.00
R0076:Megf8 UTSW 7 25353958 critical splice donor site probably null
R0217:Megf8 UTSW 7 25364079 missense probably damaging 0.99
R0514:Megf8 UTSW 7 25364303 missense possibly damaging 0.86
R0561:Megf8 UTSW 7 25328832 missense probably benign 0.21
R0563:Megf8 UTSW 7 25342395 missense probably damaging 1.00
R0601:Megf8 UTSW 7 25328540 missense probably benign 0.03
R0879:Megf8 UTSW 7 25338471 missense possibly damaging 0.58
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1323:Megf8 UTSW 7 25360102 splice site probably null
R1430:Megf8 UTSW 7 25364343 missense possibly damaging 0.86
R1445:Megf8 UTSW 7 25342656 missense probably damaging 0.97
R1533:Megf8 UTSW 7 25334855 missense possibly damaging 0.70
R1606:Megf8 UTSW 7 25358695 missense probably damaging 1.00
R1635:Megf8 UTSW 7 25346747 missense possibly damaging 0.77
R1654:Megf8 UTSW 7 25338486 missense possibly damaging 0.56
R1661:Megf8 UTSW 7 25363847 missense probably damaging 1.00
R1880:Megf8 UTSW 7 25334860 missense possibly damaging 0.68
R1962:Megf8 UTSW 7 25363551 missense probably damaging 1.00
R2077:Megf8 UTSW 7 25353738 missense probably benign 0.15
R2127:Megf8 UTSW 7 25364582 missense possibly damaging 0.73
R2129:Megf8 UTSW 7 25330715 missense probably damaging 0.98
R2199:Megf8 UTSW 7 25339614 missense possibly damaging 0.87
R2201:Megf8 UTSW 7 25340745 missense probably damaging 1.00
R2205:Megf8 UTSW 7 25341748 missense probably benign 0.13
R2207:Megf8 UTSW 7 25349797 missense probably damaging 0.97
R2361:Megf8 UTSW 7 25348954 missense possibly damaging 0.94
R2680:Megf8 UTSW 7 25317556 missense probably benign 0.01
R3084:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3085:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3086:Megf8 UTSW 7 25349019 missense probably damaging 1.00
R3433:Megf8 UTSW 7 25360124 missense probably benign 0.00
R3939:Megf8 UTSW 7 25359202 missense probably benign 0.07
R4022:Megf8 UTSW 7 25337775 missense probably damaging 1.00
R4214:Megf8 UTSW 7 25355368 missense probably benign 0.03
R4357:Megf8 UTSW 7 25355749 missense probably benign 0.02
R4521:Megf8 UTSW 7 25342701 missense probably benign 0.19
R4700:Megf8 UTSW 7 25363515 missense probably damaging 1.00
R4916:Megf8 UTSW 7 25339664 missense probably benign 0.24
R4940:Megf8 UTSW 7 25360706 missense probably damaging 1.00
R5048:Megf8 UTSW 7 25331092 missense possibly damaging 0.71
R5258:Megf8 UTSW 7 25348326 missense possibly damaging 0.88
R5271:Megf8 UTSW 7 25341706 missense probably damaging 1.00
R5390:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5391:Megf8 UTSW 7 25340289 missense possibly damaging 0.92
R5708:Megf8 UTSW 7 25334597 missense probably benign 0.03
R5752:Megf8 UTSW 7 25355114 missense probably damaging 0.97
R5930:Megf8 UTSW 7 25326441 nonsense probably null
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6037:Megf8 UTSW 7 25364406 missense probably damaging 1.00
R6153:Megf8 UTSW 7 25347371 missense possibly damaging 0.93
R6210:Megf8 UTSW 7 25343720 missense possibly damaging 0.90
R6457:Megf8 UTSW 7 25349695 missense probably damaging 0.99
R6659:Megf8 UTSW 7 25358734 missense probably benign 0.38
R6867:Megf8 UTSW 7 25331035 missense probably benign 0.42
R6896:Megf8 UTSW 7 25329932 missense probably benign 0.00
R6899:Megf8 UTSW 7 25360713 missense probably damaging 1.00
R6905:Megf8 UTSW 7 25337932 missense probably benign 0.02
R7099:Megf8 UTSW 7 25346520 missense probably damaging 0.99
R7172:Megf8 UTSW 7 25343667 missense probably damaging 0.99
R7378:Megf8 UTSW 7 25348942 missense probably damaging 1.00
R7427:Megf8 UTSW 7 25338371 missense probably benign 0.44
Z1088:Megf8 UTSW 7 25339669 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CACATGGTGGAGGCTTCTGTAG -3'
(R):5'- CACCACTTACAACGGGGAATG -3'

Sequencing Primer
(F):5'- CTTCTGTAGGACCGTGTACAAGAGAC -3'
(R):5'- CTTACAACGGGGAATGGATGCC -3'
Posted On2015-09-25