Incidental Mutation 'R0254:Ass1'
ID34525
Institutional Source Beutler Lab
Gene Symbol Ass1
Ensembl Gene ENSMUSG00000076441
Gene Nameargininosuccinate synthetase 1
SynonymsAss-1, ASS, fold
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location31470207-31520672 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31514819 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 371 (N371Y)
Ref Sequence ENSEMBL: ENSMUSP00000099904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102840]
Predicted Effect probably damaging
Transcript: ENSMUST00000102840
AA Change: N371Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099904
Gene: ENSMUSG00000076441
AA Change: N371Y

DomainStartEndE-ValueType
Pfam:QueC 6 93 2.8e-7 PFAM
Pfam:Arginosuc_synth 8 403 1.9e-177 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126474
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192802
Meta Mutation Damage Score 0.722 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the penultimate step of the arginine biosynthetic pathway. There are approximately 10 to 14 copies of this gene including the pseudogenes scattered across the human genome, among which the one located on chromosome 9 appears to be the only functional gene for argininosuccinate synthetase. Mutations in the chromosome 9 copy of this gene cause citrullinemia. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Targeted disruption of this gene results in high levels of blood citrulline, hyperammonemia, and death by 24 hours after birth. Some spontaneous mutations display wrinkled skin, sparse hair with delayed hair appearance and abnormal hair follicle morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 Y463F probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Ass1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Ass1 APN 2 31476922 missense probably damaging 1.00
IGL02152:Ass1 APN 2 31492324 missense probably damaging 1.00
R0008:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0083:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0084:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0085:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0087:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0183:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0220:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0302:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0346:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0440:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0472:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0605:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R0644:Ass1 UTSW 2 31514819 missense probably damaging 1.00
R1460:Ass1 UTSW 2 31514741 missense probably benign 0.37
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1465:Ass1 UTSW 2 31520416 makesense probably null
R1770:Ass1 UTSW 2 31486516 missense probably benign 0.29
R1908:Ass1 UTSW 2 31493148 nonsense probably null
R2361:Ass1 UTSW 2 31520382 missense probably benign 0.02
R2430:Ass1 UTSW 2 31501496 missense probably damaging 1.00
R3816:Ass1 UTSW 2 31510105 splice site probably benign
R4614:Ass1 UTSW 2 31514783 missense probably damaging 1.00
R4628:Ass1 UTSW 2 31480988 missense probably damaging 1.00
R5007:Ass1 UTSW 2 31501532 missense possibly damaging 0.90
R5069:Ass1 UTSW 2 31510173 missense probably damaging 1.00
R5081:Ass1 UTSW 2 31488653 critical splice donor site probably null
R5315:Ass1 UTSW 2 31492329 missense probably benign 0.21
R5370:Ass1 UTSW 2 31518733 missense possibly damaging 0.56
R6259:Ass1 UTSW 2 31488642 missense possibly damaging 0.80
R6541:Ass1 UTSW 2 31510233 missense probably damaging 0.99
R6731:Ass1 UTSW 2 31514784 missense probably damaging 1.00
R6927:Ass1 UTSW 2 31514801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTAAGGCAGAACCGAGCCTATC -3'
(R):5'- GCGCCACAGCCTAACTTTTATACCC -3'

Sequencing Primer
(F):5'- CCGAGCCTATCAGAAGGTAAG -3'
(R):5'- attactttgcatcagaaaatgacac -3'
Posted On2013-05-09