Incidental Mutation 'R4620:Senp3'
ID345251
Institutional Source Beutler Lab
Gene Symbol Senp3
Ensembl Gene ENSMUSG00000005204
Gene NameSUMO/sentrin specific peptidase 3
SynonymsSmt3ip1
MMRRC Submission 042008-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R4620 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69673115-69682084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69677118 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 432 (Y432F)
Ref Sequence ENSEMBL: ENSMUSP00000066581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005336] [ENSMUST00000066760] [ENSMUST00000102589] [ENSMUST00000163666]
Predicted Effect probably benign
Transcript: ENSMUST00000005336
AA Change: Y432F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005336
Gene: ENSMUSG00000005204
AA Change: Y432F

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066760
AA Change: Y432F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066581
Gene: ENSMUSG00000005204
AA Change: Y432F

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 74 86 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
Pfam:Peptidase_C48 394 566 4.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128355
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130440
Predicted Effect probably benign
Transcript: ENSMUST00000134942
SMART Domains Protein: ENSMUSP00000114791
Gene: ENSMUSG00000005204

DomainStartEndE-ValueType
Pfam:Peptidase_C48 5 167 4.1e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153516
Predicted Effect probably benign
Transcript: ENSMUST00000163666
SMART Domains Protein: ENSMUSP00000127034
Gene: ENSMUSG00000059796

DomainStartEndE-ValueType
DEXDc 51 249 3.61e-60 SMART
HELICc 286 367 1.04e-33 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reversible posttranslational modification of proteins by the addition of small ubiquitin-like SUMO proteins (see SUMO1; MIM 601912) is required for numerous biologic processes. SUMO-specific proteases, such as SENP3, are responsible for the initial processing of SUMO precursors to generate a C-terminal diglycine motif required for the conjugation reaction. They also have isopeptidase activity for the removal of SUMO from high molecular mass SUMO conjugates (Di Bacco et al., 2006 [PubMed 16738315]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A T 7: 131,343,606 Y433* probably null Het
Apba2 C T 7: 64,714,467 R331C probably damaging Het
Apod T C 16: 31,297,393 D173G probably benign Het
B3gnt5 A T 16: 19,769,882 M284L probably benign Het
Birc6 A C 17: 74,640,150 T2955P probably benign Het
Blvra T C 2: 127,096,965 I287T probably damaging Het
Capn5 T C 7: 98,129,371 Y347C probably damaging Het
Cdcp2 A G 4: 107,106,730 E259G probably damaging Het
Cdh2 A G 18: 16,648,608 V85A probably benign Het
Cdk5rap2 A G 4: 70,266,706 I1169T probably benign Het
Cenpj A G 14: 56,535,454 V1043A probably damaging Het
Cfap54 T A 10: 92,969,757 H1497L probably benign Het
Chat A G 14: 32,453,818 M95T probably damaging Het
Csmd1 T C 8: 16,002,694 probably null Het
Csmd3 T C 15: 47,585,753 E3615G probably benign Het
Cyp2c68 A T 19: 39,712,562 probably null Het
Dll1 C T 17: 15,370,566 A332T probably benign Het
Dmrta1 A T 4: 89,688,784 Q159L probably benign Het
Eci3 A T 13: 34,948,758 M212K probably damaging Het
Eml4 T C 17: 83,461,533 F557L probably benign Het
Fat3 A T 9: 15,996,894 V2604D probably damaging Het
Frem3 T C 8: 80,668,957 V1871A possibly damaging Het
Gart T C 16: 91,625,433 N732S probably damaging Het
Gas2l2 T C 11: 83,423,098 I463V probably benign Het
H2-M3 C A 17: 37,272,419 T257K probably damaging Het
Hdgf A G 3: 87,914,576 N166S possibly damaging Het
Hoxb3 A T 11: 96,345,773 N226Y probably damaging Het
Itgav T C 2: 83,755,902 Y169H probably benign Het
Kalrn T G 16: 34,028,705 I426L probably damaging Het
Kcnh3 G A 15: 99,234,101 V646M probably damaging Het
Kif6 T C 17: 49,901,296 V735A probably benign Het
Krt2 T A 15: 101,817,591 I171F probably damaging Het
Megf8 G A 7: 25,355,098 A1880T possibly damaging Het
Miox A T 15: 89,336,121 Y172F probably benign Het
Myo18a G A 11: 77,817,947 R48H possibly damaging Het
Ndufb7 T C 8: 83,566,858 S14P probably damaging Het
Npepps A T 11: 97,238,244 H371Q probably damaging Het
Olfr596 C T 7: 103,309,958 T79I probably benign Het
Olfr672 T A 7: 104,996,623 I94F probably damaging Het
Olfr876 A G 9: 37,804,819 T303A probably benign Het
Olfr976 C T 9: 39,956,909 V9M probably damaging Het
Orc5 A T 5: 22,529,176 D203E probably damaging Het
Pappa A G 4: 65,327,028 T1518A probably benign Het
Pde6a A G 18: 61,262,492 D602G probably damaging Het
Pnliprp2 G A 19: 58,762,286 V136I possibly damaging Het
Postn A C 3: 54,376,993 D627A probably damaging Het
Prpf39 T C 12: 65,042,563 V25A probably benign Het
Pxdc1 A G 13: 34,652,314 I41T probably damaging Het
Rab11fip1 T A 8: 27,154,215 E514V probably damaging Het
Rag1 A T 2: 101,643,680 H372Q probably damaging Het
Ranbp1 A G 16: 18,240,104 probably benign Het
Rexo5 A G 7: 119,827,303 I317V probably benign Het
Rragc A G 4: 123,924,829 Q279R probably damaging Het
Sbf1 A G 15: 89,306,926 S187P probably damaging Het
Slfn5 G A 11: 82,961,652 C868Y probably damaging Het
Sorcs2 C T 5: 36,037,494 A722T probably benign Het
Sptb A T 12: 76,583,807 C2244* probably null Het
Srbd1 A T 17: 86,109,265 F488L probably benign Het
Sucnr1 A G 3: 60,086,769 I239M possibly damaging Het
Themis2 A G 4: 132,786,022 W298R probably damaging Het
Tmem168 T G 6: 13,594,953 N37T probably benign Het
Tmem62 A G 2: 120,996,364 probably benign Het
Tmprss15 T C 16: 79,021,470 D524G probably damaging Het
Trav5-4 G T 14: 53,704,396 M75I probably benign Het
Trio T A 15: 27,871,171 H620L probably damaging Het
Ubap2 C T 4: 41,233,698 G64E probably damaging Het
Usp32 C A 11: 85,059,127 probably null Het
Wdfy3 A T 5: 101,906,145 F1603Y probably damaging Het
Wdr63 A T 3: 146,042,809 L850Q probably damaging Het
Xpo4 A T 14: 57,630,325 L155Q probably damaging Het
Zbtb21 T C 16: 97,949,892 T1092A possibly damaging Het
Zfp780b A T 7: 27,962,753 Y792* probably null Het
Other mutations in Senp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Senp3 APN 11 69674093 missense possibly damaging 0.50
IGL02227:Senp3 APN 11 69674530 missense possibly damaging 0.95
IGL02942:Senp3 APN 11 69677989 missense probably benign 0.02
IGL02996:Senp3 APN 11 69674260 missense probably damaging 1.00
R0784:Senp3 UTSW 11 69680448 missense probably damaging 0.99
R2474:Senp3 UTSW 11 69674097 missense probably damaging 1.00
R4619:Senp3 UTSW 11 69677118 missense probably benign 0.00
R4737:Senp3 UTSW 11 69678829 nonsense probably null
R4777:Senp3 UTSW 11 69678237 missense probably damaging 1.00
R4824:Senp3 UTSW 11 69677995 missense probably benign 0.16
R5513:Senp3 UTSW 11 69677139 missense probably benign
R5870:Senp3 UTSW 11 69678222 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGGACCTGCTGTAATTTACCCTC -3'
(R):5'- GTGGTATCCTTGGAGCCATTTC -3'

Sequencing Primer
(F):5'- TTCCATCACAGAAAGAACTCTTCTG -3'
(R):5'- GAGCCATTTCAGTTGGACAC -3'
Posted On2015-09-25