Mutagenetix > Incidental Mutation

Incidental Mutation 'R4620:Trio'

345267

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

042008-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4620 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730737-28025934 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27871257 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 620 (H620L)

Ref Sequence

ENSEMBL: ENSMUSP00000154653 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000090247
AA Change: H679L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: H679L

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000227337
AA Change: H620L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228406

Meta Mutation Damage Score

0.5341

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	A	T	7: 130,945,335 (GRCm39)	Y433*	probably null	Het
Apba2	C	T	7: 64,364,215 (GRCm39)	R331C	probably damaging	Het
Apod	T	C	16: 31,116,211 (GRCm39)	D173G	probably benign	Het
B3gnt5	A	T	16: 19,588,632 (GRCm39)	M284L	probably benign	Het
Birc6	A	C	17: 74,947,145 (GRCm39)	T2955P	probably benign	Het
Blvra	T	C	2: 126,938,885 (GRCm39)	I287T	probably damaging	Het
Capn5	T	C	7: 97,778,578 (GRCm39)	Y347C	probably damaging	Het
Cdcp2	A	G	4: 106,963,927 (GRCm39)	E259G	probably damaging	Het
Cdh2	A	G	18: 16,781,665 (GRCm39)	V85A	probably benign	Het
Cdk5rap2	A	G	4: 70,184,943 (GRCm39)	I1169T	probably benign	Het
Cenpj	A	G	14: 56,772,911 (GRCm39)	V1043A	probably damaging	Het
Cfap54	T	A	10: 92,805,619 (GRCm39)	H1497L	probably benign	Het
Chat	A	G	14: 32,175,775 (GRCm39)	M95T	probably damaging	Het
Csmd1	T	C	8: 16,052,694 (GRCm39)		probably null	Het
Csmd3	T	C	15: 47,449,149 (GRCm39)	E3615G	probably benign	Het
Cyp2c68	A	T	19: 39,701,006 (GRCm39)		probably null	Het
Dll1	C	T	17: 15,590,828 (GRCm39)	A332T	probably benign	Het
Dmrta1	A	T	4: 89,577,021 (GRCm39)	Q159L	probably benign	Het
Dnai3	A	T	3: 145,748,564 (GRCm39)	L850Q	probably damaging	Het
Eci3	A	T	13: 35,132,741 (GRCm39)	M212K	probably damaging	Het
Eml4	T	C	17: 83,768,962 (GRCm39)	F557L	probably benign	Het
Fat3	A	T	9: 15,908,190 (GRCm39)	V2604D	probably damaging	Het
Frem3	T	C	8: 81,395,586 (GRCm39)	V1871A	possibly damaging	Het
Gart	T	C	16: 91,422,321 (GRCm39)	N732S	probably damaging	Het
Gas2l2	T	C	11: 83,313,924 (GRCm39)	I463V	probably benign	Het
H2-M3	C	A	17: 37,583,310 (GRCm39)	T257K	probably damaging	Het
Hdgf	A	G	3: 87,821,883 (GRCm39)	N166S	possibly damaging	Het
Hoxb3	A	T	11: 96,236,599 (GRCm39)	N226Y	probably damaging	Het
Itgav	T	C	2: 83,586,246 (GRCm39)	Y169H	probably benign	Het
Kalrn	T	G	16: 33,849,075 (GRCm39)	I426L	probably damaging	Het
Kcnh3	G	A	15: 99,131,982 (GRCm39)	V646M	probably damaging	Het
Kif6	T	C	17: 50,208,324 (GRCm39)	V735A	probably benign	Het
Krt1c	T	A	15: 101,726,026 (GRCm39)	I171F	probably damaging	Het
Megf8	G	A	7: 25,054,523 (GRCm39)	A1880T	possibly damaging	Het
Miox	A	T	15: 89,220,324 (GRCm39)	Y172F	probably benign	Het
Myo18a	G	A	11: 77,708,773 (GRCm39)	R48H	possibly damaging	Het
Ndufb7	T	C	8: 84,293,487 (GRCm39)	S14P	probably damaging	Het
Npepps	A	T	11: 97,129,070 (GRCm39)	H371Q	probably damaging	Het
Or10d5j	C	T	9: 39,868,205 (GRCm39)	V9M	probably damaging	Het
Or52e15	T	A	7: 104,645,830 (GRCm39)	I94F	probably damaging	Het
Or52e19	C	T	7: 102,959,165 (GRCm39)	T79I	probably benign	Het
Or8b12c	A	G	9: 37,716,115 (GRCm39)	T303A	probably benign	Het
Orc5	A	T	5: 22,734,174 (GRCm39)	D203E	probably damaging	Het
Pappa	A	G	4: 65,245,265 (GRCm39)	T1518A	probably benign	Het
Pde6a	A	G	18: 61,395,563 (GRCm39)	D602G	probably damaging	Het
Pnliprp2	G	A	19: 58,750,718 (GRCm39)	V136I	possibly damaging	Het
Postn	A	C	3: 54,284,414 (GRCm39)	D627A	probably damaging	Het
Prpf39	T	C	12: 65,089,337 (GRCm39)	V25A	probably benign	Het
Pxdc1	A	G	13: 34,836,297 (GRCm39)	I41T	probably damaging	Het
Rab11fip1	T	A	8: 27,644,243 (GRCm39)	E514V	probably damaging	Het
Rag1	A	T	2: 101,474,025 (GRCm39)	H372Q	probably damaging	Het
Ranbp1	A	G	16: 18,057,968 (GRCm39)		probably benign	Het
Rexo5	A	G	7: 119,426,526 (GRCm39)	I317V	probably benign	Het
Rragc	A	G	4: 123,818,622 (GRCm39)	Q279R	probably damaging	Het
Sbf1	A	G	15: 89,191,129 (GRCm39)	S187P	probably damaging	Het
Senp3	T	A	11: 69,567,944 (GRCm39)	Y432F	probably benign	Het
Slfn5	G	A	11: 82,852,478 (GRCm39)	C868Y	probably damaging	Het
Sorcs2	C	T	5: 36,194,838 (GRCm39)	A722T	probably benign	Het
Sptb	A	T	12: 76,630,581 (GRCm39)	C2244*	probably null	Het
Srbd1	A	T	17: 86,416,693 (GRCm39)	F488L	probably benign	Het
Sucnr1	A	G	3: 59,994,190 (GRCm39)	I239M	possibly damaging	Het
Themis2	A	G	4: 132,513,333 (GRCm39)	W298R	probably damaging	Het
Tmem168	T	G	6: 13,594,952 (GRCm39)	N37T	probably benign	Het
Tmem62	A	G	2: 120,826,845 (GRCm39)		probably benign	Het
Tmprss15	T	C	16: 78,818,358 (GRCm39)	D524G	probably damaging	Het
Trav5-4	G	T	14: 53,941,853 (GRCm39)	M75I	probably benign	Het
Ubap2	C	T	4: 41,233,698 (GRCm39)	G64E	probably damaging	Het
Usp32	C	A	11: 84,949,953 (GRCm39)		probably null	Het
Wdfy3	A	T	5: 102,054,011 (GRCm39)	F1603Y	probably damaging	Het
Xpo4	A	T	14: 57,867,782 (GRCm39)	L155Q	probably damaging	Het
Zbtb21	T	C	16: 97,751,092 (GRCm39)	T1092A	possibly damaging	Het
Zfp780b	A	T	7: 27,662,178 (GRCm39)	Y792*	probably null	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27,912,829 (GRCm39)	splice site	probably benign
IGL01011:Trio	APN	15	27,736,575 (GRCm39)	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27,773,093 (GRCm39)	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27,818,253 (GRCm39)	splice site	probably benign
IGL01147:Trio	APN	15	27,881,406 (GRCm39)	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27,749,867 (GRCm39)	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27,905,409 (GRCm39)	missense	probably benign	0.42
IGL01352:Trio	APN	15	27,901,315 (GRCm39)	missense	probably benign	0.01
IGL01366:Trio	APN	15	27,732,954 (GRCm39)	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27,838,861 (GRCm39)	splice site	probably benign
IGL01454:Trio	APN	15	27,833,071 (GRCm39)	missense	probably benign	0.32
IGL01695:Trio	APN	15	27,773,087 (GRCm39)	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27,764,112 (GRCm39)	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27,846,896 (GRCm39)	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27,741,119 (GRCm39)	missense	probably benign	0.12
IGL01991:Trio	APN	15	27,871,360 (GRCm39)	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27,744,244 (GRCm39)	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27,744,139 (GRCm39)	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27,902,647 (GRCm39)	missense	probably benign	0.24
IGL02304:Trio	APN	15	27,735,522 (GRCm39)	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27,847,476 (GRCm39)	nonsense	probably null
IGL02508:Trio	APN	15	27,818,190 (GRCm39)	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27,845,016 (GRCm39)	splice site	probably benign
IGL02617:Trio	APN	15	27,841,935 (GRCm39)	splice site	probably benign
IGL02675:Trio	APN	15	27,768,125 (GRCm39)	unclassified	probably benign
IGL02817:Trio	APN	15	27,902,967 (GRCm39)	missense	probably benign	0.01
IGL02993:Trio	APN	15	27,830,325 (GRCm39)	splice site	probably benign
IGL03007:Trio	APN	15	27,902,828 (GRCm39)	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27,832,097 (GRCm39)	splice site	probably benign
IGL03225:Trio	APN	15	27,902,781 (GRCm39)	missense	probably benign	0.30
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0063:Trio	UTSW	15	27,881,523 (GRCm39)	splice site	probably benign
R0302:Trio	UTSW	15	27,902,603 (GRCm39)	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27,767,993 (GRCm39)	missense	probably benign	0.00
R0506:Trio	UTSW	15	27,855,049 (GRCm39)	missense	probably benign	0.12
R0564:Trio	UTSW	15	27,805,908 (GRCm39)	missense	probably damaging	1.00
R0659:Trio	UTSW	15	27,831,485 (GRCm39)	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27,732,980 (GRCm39)	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27,741,336 (GRCm39)	critical splice donor site	probably null
R1018:Trio	UTSW	15	27,871,257 (GRCm39)	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27,898,000 (GRCm39)	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27,753,890 (GRCm39)	splice site	probably benign
R1488:Trio	UTSW	15	27,741,053 (GRCm39)	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27,732,726 (GRCm39)	missense	probably benign	0.28
R1531:Trio	UTSW	15	27,833,071 (GRCm39)	missense	probably benign	0.32
R1640:Trio	UTSW	15	27,833,130 (GRCm39)	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27,758,433 (GRCm39)	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27,744,232 (GRCm39)	splice site	probably null
R1780:Trio	UTSW	15	27,744,124 (GRCm39)	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27,841,842 (GRCm39)	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27,748,426 (GRCm39)	missense	probably benign
R1817:Trio	UTSW	15	27,742,581 (GRCm39)	nonsense	probably null
R1853:Trio	UTSW	15	27,756,622 (GRCm39)	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27,742,466 (GRCm39)	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27,833,142 (GRCm39)	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27,732,977 (GRCm39)	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27,774,013 (GRCm39)	missense	probably damaging	1.00
R2025:Trio	UTSW	15	27,744,223 (GRCm39)	missense	probably damaging	0.99
R2050:Trio	UTSW	15	27,852,031 (GRCm39)	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27,824,061 (GRCm39)	splice site	probably null
R2913:Trio	UTSW	15	27,854,998 (GRCm39)	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27,805,862 (GRCm39)	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27,748,177 (GRCm39)	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27,833,156 (GRCm39)	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27,744,187 (GRCm39)	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27,749,883 (GRCm39)	nonsense	probably null
R4370:Trio	UTSW	15	27,748,423 (GRCm39)	nonsense	probably null
R4547:Trio	UTSW	15	27,819,068 (GRCm39)	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27,773,084 (GRCm39)	small deletion	probably benign
R4735:Trio	UTSW	15	27,752,875 (GRCm39)	splice site	probably null
R4764:Trio	UTSW	15	27,732,624 (GRCm39)	nonsense	probably null
R4775:Trio	UTSW	15	27,881,428 (GRCm39)	nonsense	probably null
R4942:Trio	UTSW	15	27,752,811 (GRCm39)	missense	probably benign	0.21
R5004:Trio	UTSW	15	27,755,264 (GRCm39)	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27,754,115 (GRCm39)	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27,902,686 (GRCm39)	missense	probably benign	0.00
R5186:Trio	UTSW	15	27,898,077 (GRCm39)	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27,748,372 (GRCm39)	missense	probably benign	0.02
R5344:Trio	UTSW	15	27,735,618 (GRCm39)	missense	probably benign	0.12
R5407:Trio	UTSW	15	27,844,892 (GRCm39)	splice site	probably null
R5442:Trio	UTSW	15	27,856,280 (GRCm39)	missense	probably benign	0.04
R5617:Trio	UTSW	15	27,902,834 (GRCm39)	missense	probably benign
R5778:Trio	UTSW	15	27,856,250 (GRCm39)	missense	probably benign	0.33
R5986:Trio	UTSW	15	27,852,019 (GRCm39)	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27,891,545 (GRCm39)	missense	probably benign	0.10
R6011:Trio	UTSW	15	27,735,631 (GRCm39)	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27,891,465 (GRCm39)	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27,818,157 (GRCm39)	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27,744,038 (GRCm39)	critical splice donor site	probably null
R6387:Trio	UTSW	15	27,752,825 (GRCm39)	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27,902,997 (GRCm39)	missense	probably benign	0.02
R6478:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R6528:Trio	UTSW	15	27,805,956 (GRCm39)	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27,855,082 (GRCm39)	missense	probably benign	0.00
R6825:Trio	UTSW	15	27,889,394 (GRCm39)	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27,919,374 (GRCm39)	unclassified	probably benign
R6945:Trio	UTSW	15	27,824,176 (GRCm39)	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27,805,740 (GRCm39)	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27,832,137 (GRCm39)	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27,749,885 (GRCm39)	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27,898,086 (GRCm39)	missense	unknown
R7094:Trio	UTSW	15	27,891,534 (GRCm39)	missense	unknown
R7123:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27,742,399 (GRCm39)	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27,871,273 (GRCm39)	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27,828,437 (GRCm39)	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27,871,375 (GRCm39)	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27,732,962 (GRCm39)	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27,856,193 (GRCm39)	missense	probably benign	0.01
R7451:Trio	UTSW	15	27,747,999 (GRCm39)	missense	probably benign	0.07
R7558:Trio	UTSW	15	27,831,480 (GRCm39)	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27,855,025 (GRCm39)	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27,749,912 (GRCm39)	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27,736,531 (GRCm39)	critical splice donor site	probably null
R7609:Trio	UTSW	15	27,912,728 (GRCm39)	missense	unknown
R7767:Trio	UTSW	15	27,889,504 (GRCm39)	missense	unknown
R7784:Trio	UTSW	15	27,764,080 (GRCm39)	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R7833:Trio	UTSW	15	27,774,172 (GRCm39)	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27,805,770 (GRCm39)	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27,852,010 (GRCm39)	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27,773,021 (GRCm39)	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27,749,952 (GRCm39)	missense	probably benign	0.35
R8050:Trio	UTSW	15	27,891,540 (GRCm39)	missense	unknown
R8217:Trio	UTSW	15	27,819,055 (GRCm39)	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27,902,996 (GRCm39)	missense	unknown
R8283:Trio	UTSW	15	27,756,628 (GRCm39)	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27,855,108 (GRCm39)	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27,881,412 (GRCm39)	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27,774,038 (GRCm39)	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27,901,286 (GRCm39)	missense	probably benign	0.25
R8682:Trio	UTSW	15	27,905,278 (GRCm39)	missense	unknown
R8688:Trio	UTSW	15	27,748,324 (GRCm39)	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27,732,632 (GRCm39)	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27,919,323 (GRCm39)	missense	unknown
R8713:Trio	UTSW	15	27,744,037 (GRCm39)	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27,851,923 (GRCm39)	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27,905,311 (GRCm39)	missense	unknown
R8816:Trio	UTSW	15	27,741,357 (GRCm39)	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27,741,150 (GRCm39)	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27,732,773 (GRCm39)	missense	probably benign	0.23
R9051:Trio	UTSW	15	27,732,770 (GRCm39)	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27,852,097 (GRCm39)	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27,774,022 (GRCm39)	nonsense	probably null
R9079:Trio	UTSW	15	27,733,023 (GRCm39)	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27,749,922 (GRCm39)	nonsense	probably null
R9494:Trio	UTSW	15	27,846,843 (GRCm39)	missense	probably benign	0.00
R9680:Trio	UTSW	15	27,744,158 (GRCm39)	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27,847,495 (GRCm39)	missense	probably benign	0.00
R9726:Trio	UTSW	15	27,912,752 (GRCm39)	missense	unknown
X0024:Trio	UTSW	15	27,765,812 (GRCm39)	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27,771,473 (GRCm39)	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTCATGTGACAAGGACAGCC -3'
(R):5'- TATCCTCCCGTGCAGAACAC -3'

Sequencing Primer
(F):5'- GAAGGCAGGAAGGCATCTTC -3'
(R):5'- ACGTACACAAACGCAGATAAACTG -3'

Posted On

2015-09-25