Incidental Mutation 'R0254:Fap'
ID34527
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Namefibroblast activation protein
Synonyms
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location62500943-62574075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62503402 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 633 (G633D)
Ref Sequence ENSEMBL: ENSMUSP00000000402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000128139] [ENSMUST00000174234] [ENSMUST00000174448]
Predicted Effect probably damaging
Transcript: ENSMUST00000000402
AA Change: G633D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: G633D

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102732
AA Change: G666D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: G666D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128139
AA Change: G8D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect probably damaging
Transcript: ENSMUST00000174234
AA Change: G641D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: G641D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174448
AA Change: G661D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: G661D

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R2136:Fap UTSW 2 62524207 missense possibly damaging 0.94
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4517:Fap UTSW 2 62530715 missense probably benign 0.01
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5898:Fap UTSW 2 62573503 missense probably benign
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5944:Fap UTSW 2 62542261 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6505:Fap UTSW 2 62546603 nonsense probably null
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCATAAATGATACCCGCTCAAGC -3'
(R):5'- AGTGTACCTCAGAGTCTTCCCACG -3'

Sequencing Primer
(F):5'- CCGCTCAAGCTGTGTAGG -3'
(R):5'- AGTCTTCCCACGGGAGAAC -3'
Posted On2013-05-09