Incidental Mutation 'R3982:Clca3a1'
ID345298
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Namechloride channel accessory 3A1
SynonymsClca1
MMRRC Submission 041608-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3982 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144729677-144760977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144755309 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 194 (T194S)
Ref Sequence ENSEMBL: ENSMUSP00000029932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
Predicted Effect probably benign
Transcript: ENSMUST00000029932
AA Change: T194S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: T194S

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059091
AA Change: T194S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: T194S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,542,369 probably null Het
Adgrg6 T C 10: 14,448,845 N445S probably benign Het
Adgrl3 A G 5: 81,694,526 T902A possibly damaging Het
Atf4 T C 15: 80,256,868 V153A probably benign Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Bsn T C 9: 108,107,166 T3230A unknown Het
Cadps2 A G 6: 23,263,531 probably benign Het
Cth A T 3: 157,913,697 L163* probably null Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Frmd6 T C 12: 70,887,834 L269P probably damaging Het
Gpr62 G A 9: 106,464,886 A281V probably benign Het
Hapln1 T A 13: 89,605,441 F242Y probably benign Het
Ighv1-39 A T 12: 114,914,631 S107T possibly damaging Het
Itga8 A G 2: 12,300,963 V72A possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Klre1 T A 6: 129,583,138 C124* probably null Het
Lrrk2 T A 15: 91,709,284 M482K probably benign Het
Man2b2 T C 5: 36,813,820 N734S probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mdga1 C A 17: 29,931,264 A125S unknown Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Nifk T A 1: 118,329,552 S138R possibly damaging Het
Nlrp4b T C 7: 10,714,431 V187A possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pigo A T 4: 43,023,482 S231T probably benign Het
Pik3cb G A 9: 99,046,601 T867M probably benign Het
Plag1 A T 4: 3,904,055 S379T probably damaging Het
Polg2 G A 11: 106,779,202 R81* probably null Het
Prpf4b C T 13: 34,884,213 probably benign Het
Ptprq T A 10: 107,543,396 I1981F probably damaging Het
Usp24 G A 4: 106,387,883 E1307K probably benign Het
Vmn2r115 T A 17: 23,359,974 M807K probably damaging Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Clca3a1 APN 3 144755251 missense probably damaging 0.96
IGL01331:Clca3a1 APN 3 144747512 missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144747572 nonsense probably null
IGL01940:Clca3a1 APN 3 144746976 missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144754803 missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144751929 splice site probably benign
IGL03093:Clca3a1 APN 3 144747501 missense probably damaging 0.99
Lucha UTSW 3 144749689 missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144730879 missense probably damaging 0.98
R0513:Clca3a1 UTSW 3 144760562 critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144748394 splice site probably benign
R1522:Clca3a1 UTSW 3 144755171 missense probably benign 0.01
R1744:Clca3a1 UTSW 3 144746835 missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144746829 missense probably damaging 0.99
R2238:Clca3a1 UTSW 3 144752005 missense possibly damaging 0.94
R2278:Clca3a1 UTSW 3 144758024 missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144737858 splice site probably null
R3737:Clca3a1 UTSW 3 144730721 missense probably benign 0.01
R3981:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R3983:Clca3a1 UTSW 3 144755309 missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144755233 missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144760722 start codon destroyed probably benign 0.08
R4543:Clca3a1 UTSW 3 144746988 missense probably damaging 1.00
R4766:Clca3a1 UTSW 3 144749712 missense probably damaging 1.00
R4899:Clca3a1 UTSW 3 144737961 missense probably damaging 1.00
R5090:Clca3a1 UTSW 3 144737872 missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144730722 missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144746784 missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144737136 missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144737005 missense possibly damaging 0.77
R5871:Clca3a1 UTSW 3 144754881 missense probably damaging 1.00
R5907:Clca3a1 UTSW 3 144749642 intron probably benign
R5976:Clca3a1 UTSW 3 144746875 missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144758060 missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144759232 missense possibly damaging 0.65
R6263:Clca3a1 UTSW 3 144749778 missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144758514 missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144730797 missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144759259 missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144759260 missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144736947 missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144749689 missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144747568 missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144755206 missense probably damaging 0.97
R7139:Clca3a1 UTSW 3 144755302 missense possibly damaging 0.58
Z1088:Clca3a1 UTSW 3 144746953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTACACGCTTGGAGGGTC -3'
(R):5'- CAATAGCAGTTGCCACAGAGAG -3'

Sequencing Primer
(F):5'- ACGCTTGGAGGGTCATCGAG -3'
(R):5'- CAGTTGCCACAGAGAGATTTTAG -3'
Posted On2015-09-25