Incidental Mutation 'R3982:Frmd6'
ID345318
Institutional Source Beutler Lab
Gene Symbol Frmd6
Ensembl Gene ENSMUSG00000048285
Gene NameFERM domain containing 6
Synonyms
MMRRC Submission 041608-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3982 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location70825514-70902234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70887834 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 269 (L269P)
Ref Sequence ENSEMBL: ENSMUSP00000052202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057859]
Predicted Effect probably damaging
Transcript: ENSMUST00000057859
AA Change: L269P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052202
Gene: ENSMUSG00000048285
AA Change: L269P

DomainStartEndE-ValueType
B41 13 234 2.41e-25 SMART
FERM_C 241 332 9.63e-19 SMART
low complexity region 365 375 N/A INTRINSIC
low complexity region 382 395 N/A INTRINSIC
low complexity region 425 442 N/A INTRINSIC
low complexity region 506 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222802
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik A G 2: 19,542,369 probably null Het
Adgrg6 T C 10: 14,448,845 N445S probably benign Het
Adgrl3 A G 5: 81,694,526 T902A possibly damaging Het
Atf4 T C 15: 80,256,868 V153A probably benign Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Bsn T C 9: 108,107,166 T3230A unknown Het
Cadps2 A G 6: 23,263,531 probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Cth A T 3: 157,913,697 L163* probably null Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gpr62 G A 9: 106,464,886 A281V probably benign Het
Hapln1 T A 13: 89,605,441 F242Y probably benign Het
Ighv1-39 A T 12: 114,914,631 S107T possibly damaging Het
Itga8 A G 2: 12,300,963 V72A possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Klre1 T A 6: 129,583,138 C124* probably null Het
Lrrk2 T A 15: 91,709,284 M482K probably benign Het
Man2b2 T C 5: 36,813,820 N734S probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mdga1 C A 17: 29,931,264 A125S unknown Het
Mmd2 T C 5: 142,564,799 Y228C probably damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Nifk T A 1: 118,329,552 S138R possibly damaging Het
Nlrp4b T C 7: 10,714,431 V187A possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pigo A T 4: 43,023,482 S231T probably benign Het
Pik3cb G A 9: 99,046,601 T867M probably benign Het
Plag1 A T 4: 3,904,055 S379T probably damaging Het
Polg2 G A 11: 106,779,202 R81* probably null Het
Prpf4b C T 13: 34,884,213 probably benign Het
Ptprq T A 10: 107,543,396 I1981F probably damaging Het
Usp24 G A 4: 106,387,883 E1307K probably benign Het
Vmn2r115 T A 17: 23,359,974 M807K probably damaging Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Other mutations in Frmd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0629:Frmd6 UTSW 12 70883762 missense probably damaging 1.00
R0662:Frmd6 UTSW 12 70899444 nonsense probably null
R0747:Frmd6 UTSW 12 70864056 missense probably benign
R1144:Frmd6 UTSW 12 70877168 missense probably damaging 1.00
R1366:Frmd6 UTSW 12 70887889 splice site probably benign
R1763:Frmd6 UTSW 12 70893622 missense possibly damaging 0.90
R2135:Frmd6 UTSW 12 70894997 missense probably benign 0.00
R2342:Frmd6 UTSW 12 70883818 nonsense probably null
R3963:Frmd6 UTSW 12 70893864 missense probably benign 0.00
R4010:Frmd6 UTSW 12 70899553 missense probably benign
R4416:Frmd6 UTSW 12 70877249 missense probably benign 0.04
R4823:Frmd6 UTSW 12 70872575 missense probably benign 0.22
R4861:Frmd6 UTSW 12 70893726 missense probably damaging 0.98
R5368:Frmd6 UTSW 12 70864100 nonsense probably null
R5806:Frmd6 UTSW 12 70890020 missense probably damaging 1.00
R6226:Frmd6 UTSW 12 70863911 start gained probably benign
R6253:Frmd6 UTSW 12 70877213 missense probably damaging 0.99
R6781:Frmd6 UTSW 12 70899643 missense possibly damaging 0.68
R7051:Frmd6 UTSW 12 70897396 missense possibly damaging 0.78
R7156:Frmd6 UTSW 12 70877209 missense probably damaging 1.00
R7481:Frmd6 UTSW 12 70887055 missense probably damaging 1.00
U24488:Frmd6 UTSW 12 70893879 missense probably damaging 0.97
X0022:Frmd6 UTSW 12 70864108 missense probably damaging 1.00
Z1088:Frmd6 UTSW 12 70880678 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CGCTGATCTTAATTACTGTCGG -3'
(R):5'- GTGAGTCATTTCACCTGCCC -3'

Sequencing Primer
(F):5'- GATCTTAATTACTGTCGGCCCTTTTC -3'
(R):5'- TGCCCCTAGCTTCTACTTAAAAAC -3'
Posted On2015-09-25