Incidental Mutation 'R4598:Mep1a'
ID345387
Institutional Source Beutler Lab
Gene Symbol Mep1a
Ensembl Gene ENSMUSG00000023914
Gene Namemeprin 1 alpha
SynonymsMep-1a, meprin A alpha-subunit, Mep1, meprin alpha, Mep-1
MMRRC Submission 041814-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4598 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43474324-43502812 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 43491578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024707] [ENSMUST00000117137]
PDB Structure
[]
Predicted Effect probably null
Transcript: ENSMUST00000024707
SMART Domains Protein: ENSMUSP00000024707
Gene: ENSMUSG00000023914

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
ZnMc 83 222 1.16e-41 SMART
MAM 276 445 5.38e-61 SMART
MATH 445 590 6.9e-17 SMART
EGF 687 724 1.35e-2 SMART
transmembrane domain 727 749 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117137
SMART Domains Protein: ENSMUSP00000113838
Gene: ENSMUSG00000023914

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
ZnMc 70 209 1.16e-41 SMART
MAM 263 432 5.38e-61 SMART
MATH 432 577 6.9e-17 SMART
EGF 674 711 1.35e-2 SMART
transmembrane domain 714 736 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased litter size, reduced LPS-induced renal injury and bladder inflammation, and increased susceptibility to sodium dextran sulfate-induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik G A 1: 11,747,964 probably null Het
Abca14 T C 7: 120,255,403 V930A probably benign Het
Abcb7 A C X: 104,323,382 D135E probably benign Het
Ace T A 11: 105,981,759 probably null Het
Acnat1 T C 4: 49,450,781 D110G probably benign Het
Ak9 C T 10: 41,383,911 P862S probably damaging Het
Atp1a3 A G 7: 24,979,341 S972P probably damaging Het
Bmf C A 2: 118,549,128 A56S probably benign Het
C6 T C 15: 4,763,370 L319P possibly damaging Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cdc14b T C 13: 64,247,274 T69A probably benign Het
Cep162 A G 9: 87,203,795 Y1159H possibly damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clca3a2 A T 3: 144,805,683 N41K probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Cyp3a57 A G 5: 145,390,417 I473V probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Eif4e3 T A 6: 99,640,710 I67L probably benign Het
Epor A G 9: 21,961,859 S86P probably benign Het
Esp31 T A 17: 38,641,121 probably null Het
Esrp2 A G 8: 106,132,711 M498T probably damaging Het
F5 T C 1: 164,204,797 I1771T probably benign Het
Fancd2 C A 6: 113,585,477 H1259Q probably benign Het
Gale C A 4: 135,967,837 S341* probably null Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Kat2b A G 17: 53,670,798 Y791C probably benign Het
Kazn A G 4: 142,210,092 V108A possibly damaging Het
Kcnma1 T C 14: 23,803,160 T109A probably damaging Het
Med13 T C 11: 86,278,566 T1955A probably damaging Het
Megf10 G A 18: 57,189,603 probably null Het
Megf10 A T 18: 57,287,812 S841C probably damaging Het
Mrap2 A T 9: 87,182,789 E194D probably damaging Het
Msh2 A G 17: 87,708,578 K546R probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrip1 A G 16: 76,293,080 F530L probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr1504 A T 19: 13,888,017 H64Q probably damaging Het
Olfr676 A C 7: 105,036,073 I292L probably benign Het
Olfr812 T C 10: 129,842,995 T16A possibly damaging Het
Oxtr C T 6: 112,489,752 G16R probably benign Het
Pdgfrb A T 18: 61,068,757 K464N probably benign Het
Pja2 A T 17: 64,313,030 M1K probably null Het
Pkhd1 A T 1: 20,503,056 N1875K probably damaging Het
Pogz T C 3: 94,880,180 S1360P possibly damaging Het
Proc A T 18: 32,123,459 L385Q probably damaging Het
Ptprm A G 17: 67,095,497 I132T probably benign Het
Rpgr A G X: 10,196,016 S343P probably benign Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Scyl1 A G 19: 5,770,453 S118P probably damaging Het
Sec61a1 T C 6: 88,506,149 N414D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Sema7a A G 9: 57,953,551 D65G probably benign Het
Slc25a45 A G 19: 5,884,436 Y144C probably damaging Het
Slc26a6 A G 9: 108,856,380 Y103C probably damaging Het
Stat3 C T 11: 100,903,674 D270N probably damaging Het
Taar8b T C 10: 24,091,838 S153G probably benign Het
Top1 A G 2: 160,720,965 E697G possibly damaging Het
Trappc11 G A 8: 47,513,766 T470I probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Usp29 A G 7: 6,962,480 T441A probably benign Het
Vmn2r110 A T 17: 20,583,767 L182* probably null Het
Zgrf1 T C 3: 127,601,030 I1345T probably benign Het
Zscan25 G T 5: 145,291,005 R493L probably benign Het
Other mutations in Mep1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Mep1a APN 17 43479084 missense probably benign 0.00
IGL02814:Mep1a APN 17 43477221 missense probably benign
IGL03000:Mep1a APN 17 43474990 missense probably benign
IGL03335:Mep1a APN 17 43477173 missense possibly damaging 0.63
IGL03410:Mep1a APN 17 43478095 splice site probably null
PIT4544001:Mep1a UTSW 17 43482287 missense probably damaging 1.00
R0127:Mep1a UTSW 17 43497886 splice site probably benign
R0306:Mep1a UTSW 17 43502643 splice site probably benign
R0329:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0330:Mep1a UTSW 17 43497898 critical splice donor site probably null
R0358:Mep1a UTSW 17 43478950 missense possibly damaging 0.92
R0667:Mep1a UTSW 17 43478190 missense probably benign 0.06
R1101:Mep1a UTSW 17 43491693 missense probably benign 0.03
R1458:Mep1a UTSW 17 43491672 missense probably damaging 1.00
R1525:Mep1a UTSW 17 43491636 missense probably damaging 1.00
R1992:Mep1a UTSW 17 43502682 missense probably benign
R2014:Mep1a UTSW 17 43497906 missense probably benign 0.01
R2212:Mep1a UTSW 17 43477263 missense probably benign 0.02
R3946:Mep1a UTSW 17 43475041 nonsense probably null
R4400:Mep1a UTSW 17 43475006 missense possibly damaging 0.77
R4616:Mep1a UTSW 17 43486241 missense possibly damaging 0.81
R4688:Mep1a UTSW 17 43482248 missense possibly damaging 0.89
R5085:Mep1a UTSW 17 43478144 missense probably damaging 0.99
R5355:Mep1a UTSW 17 43477146 missense probably damaging 0.98
R5832:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5833:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5834:Mep1a UTSW 17 43478164 missense probably benign 0.27
R5835:Mep1a UTSW 17 43478164 missense probably benign 0.27
R6280:Mep1a UTSW 17 43502392 missense probably damaging 1.00
R6340:Mep1a UTSW 17 43479058 missense probably benign 0.00
R6340:Mep1a UTSW 17 43479233 missense probably benign 0.00
R6934:Mep1a UTSW 17 43482230 missense probably damaging 0.99
R7247:Mep1a UTSW 17 43475104 missense possibly damaging 0.67
Z1088:Mep1a UTSW 17 43491596 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTTTTATATCGAGCTTGAAC -3'
(R):5'- AAAGGTGCTGGTCTATGATTGG -3'

Sequencing Primer
(F):5'- TACTGATACAAAGCATACACATGGG -3'
(R):5'- TTGGTGATCAACAGGTGGGAC -3'
Posted On2015-09-25