Incidental Mutation 'R0254:Kit'
ID34542
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75620921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 337 (V337I)
Ref Sequence ENSEMBL: ENSMUSP00000116465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: V337I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: V337I

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143221
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: V337I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: V337I

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 Y463F probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
Casper UTSW 5 75645875 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTTCTCACGGGTGCCAGTCAAC -3'
(R):5'- AGCCCCAGATGTCCTTCCTCAATG -3'

Sequencing Primer
(F):5'- ACACTGGAAGCCGTCATTTG -3'
(R):5'- TCATTGCTGGGTCACCAAAC -3'
Posted On2013-05-09