Incidental Mutation 'R4599:Msh2'
ID345475
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene NamemutS homolog 2
Synonyms
MMRRC Submission 041815-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R4599 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87672330-87723713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87708578 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 546 (K546R)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
Predicted Effect probably damaging
Transcript: ENSMUST00000024967
AA Change: K546R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: K546R

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173097
Predicted Effect probably benign
Transcript: ENSMUST00000174703
SMART Domains Protein: ENSMUSP00000133488
Gene: ENSMUSG00000024151

DomainStartEndE-ValueType
Blast:MUTSd 2 63 7e-37 BLAST
PDB:2O8E|A 2 63 4e-32 PDB
SCOP:d1e3ma1 5 53 2e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 120,255,403 V930A probably benign Het
Ankrd13b T C 11: 77,471,668 R677G probably benign Het
Apc T A 18: 34,317,987 Y2611* probably null Het
Apold1 A G 6: 134,984,069 Y162C probably damaging Het
Atp6v0a4 T C 6: 38,078,802 I325V probably benign Het
Cab39 A G 1: 85,848,329 Y249C probably damaging Het
Cd22 T A 7: 30,875,900 H239L probably damaging Het
Chrna7 A G 7: 63,103,790 M327T probably damaging Het
Clock T C 5: 76,235,810 M499V probably benign Het
Clspn A G 4: 126,581,460 E1002G probably benign Het
Clta C T 4: 44,012,819 P10S probably damaging Het
Col5a3 A G 9: 20,774,559 probably null Het
Coq6 T C 12: 84,362,139 V30A probably benign Het
Csmd2 G T 4: 127,988,128 R20L probably benign Het
D430041D05Rik A T 2: 104,208,183 V1547D probably damaging Het
Dapk1 C T 13: 60,718,047 P153S probably benign Het
Dock2 T A 11: 34,239,536 Y1545F probably damaging Het
Dpp6 G T 5: 27,634,548 G354C probably damaging Het
Dyrk1b T C 7: 28,182,431 L105P probably damaging Het
Epor A G 9: 21,961,859 S86P probably benign Het
Fam166b T C 4: 43,427,574 H250R possibly damaging Het
Gale C A 4: 135,967,837 S341* probably null Het
Galnt4 T A 10: 99,109,493 V360E probably damaging Het
Gart A T 16: 91,622,945 C24* probably null Het
Gcnt2 G T 13: 40,887,490 V42L probably benign Het
Herc6 A G 6: 57,659,713 I805V probably benign Het
Ints12 T A 3: 133,098,453 I67N probably benign Het
Irx1 C A 13: 71,960,113 R150L probably damaging Het
Kif26b A G 1: 178,530,459 Y45C unknown Het
Krt35 T C 11: 100,094,008 T275A probably damaging Het
Laptm5 G T 4: 130,916,005 probably benign Het
Lin7a T C 10: 107,412,166 S111P unknown Het
Med27 A G 2: 29,524,458 D159G probably damaging Het
Myo1a A T 10: 127,720,151 probably null Het
Myo1c T C 11: 75,668,193 F604L probably damaging Het
Myrip A G 9: 120,464,784 K782E probably damaging Het
Ndc80 T C 17: 71,521,068 D88G probably damaging Het
Nrxn2 A G 19: 6,455,252 D375G probably damaging Het
Olfr1380 T C 11: 49,564,718 S266P probably damaging Het
Olfr676 A G 7: 105,036,073 I292V probably benign Het
Padi3 T C 4: 140,798,111 H187R probably damaging Het
Pcdhgb1 A T 18: 37,681,557 N367I probably damaging Het
Pdrg1 T C 2: 153,012,390 I77V probably benign Het
Pfas T C 11: 68,991,069 E930G probably benign Het
Pik3cb C T 9: 99,061,764 R662Q probably benign Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Plxnd1 A T 6: 115,994,276 V177E probably damaging Het
Prmt7 A G 8: 106,250,329 S558G possibly damaging Het
Pspc1 A C 14: 56,777,789 probably null Het
Rilp T C 11: 75,512,760 S343P probably benign Het
Ror1 A G 4: 100,407,910 M194V probably damaging Het
Rsu1 T C 2: 13,170,004 Y225C probably damaging Het
Rundc1 A G 11: 101,433,926 N486S probably damaging Het
Sema6d T A 2: 124,654,231 I65N probably damaging Het
Slc5a11 A G 7: 123,258,378 E230G probably benign Het
Spint1 T C 2: 119,246,460 S342P probably damaging Het
Stard3nl A G 13: 19,367,753 S214P probably damaging Het
Tcp10a A C 17: 7,336,924 T271P probably damaging Het
Tie1 A G 4: 118,472,634 Y1091H probably benign Het
Tlr12 T C 4: 128,617,332 Y375C probably benign Het
Tmem107 T A 11: 69,071,448 M77K probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tns3 T C 11: 8,531,747 K202E probably damaging Het
Tspoap1 C T 11: 87,779,521 P1634L probably damaging Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ush2a A G 1: 188,911,647 N4402S probably benign Het
Vmn2r13 A T 5: 109,156,456 I703N probably damaging Het
Xrcc4 A G 13: 90,062,007 probably null Het
Zp3 A T 5: 135,984,235 K168* probably null Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 intron probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4589:Msh2 UTSW 17 87680032 missense possibly damaging 0.67
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5014:Msh2 UTSW 17 87717576 missense possibly damaging 0.83
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
R7260:Msh2 UTSW 17 87717619 missense probably damaging 0.97
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTAATCAGATGTGGTTTTGACC -3'
(R):5'- GGGCTAACAGTGCTAAAGTATCTAC -3'

Sequencing Primer
(F):5'- CAGATGTGGTTTTGACCATTTAGACC -3'
(R):5'- CTAGCTTCTTGGAAGAGAGTAAAACC -3'
Posted On2015-09-25