Incidental Mutation 'R4600:Col6a3'
ID345480
Institutional Source Beutler Lab
Gene Symbol Col6a3
Ensembl Gene ENSMUSG00000048126
Gene Namecollagen, type VI, alpha 3
SynonymsCol6a-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location90765923-90843971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90781904 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1857 (S1857P)
Ref Sequence ENSEMBL: ENSMUSP00000140858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056925] [ENSMUST00000097653] [ENSMUST00000188587]
Predicted Effect unknown
Transcript: ENSMUST00000056925
AA Change: S2464P
SMART Domains Protein: ENSMUSP00000057131
Gene: ENSMUSG00000048126
AA Change: S2464P

DomainStartEndE-ValueType
VWA 36 214 3.58e-42 SMART
VWA 239 415 3.34e-42 SMART
VWA 442 617 7.27e-43 SMART
VWA 636 813 7.8e-43 SMART
VWA 834 1010 4.21e-39 SMART
VWA 1024 1203 3.02e-40 SMART
VWA 1228 1406 1.1e-42 SMART
VWA 1431 1604 9.17e-40 SMART
VWA 1634 1807 1.78e-37 SMART
VWA 1833 2022 7.92e-3 SMART
Pfam:Collagen 2033 2094 2e-10 PFAM
Pfam:Collagen 2077 2142 2.8e-10 PFAM
low complexity region 2179 2222 N/A INTRINSIC
low complexity region 2228 2279 N/A INTRINSIC
Pfam:Collagen 2311 2373 7.9e-11 PFAM
VWA 2397 2576 3.95e-21 SMART
VWA 2614 2813 2.25e-25 SMART
low complexity region 2864 2880 N/A INTRINSIC
low complexity region 2886 2900 N/A INTRINSIC
low complexity region 2903 2941 N/A INTRINSIC
low complexity region 2945 3024 N/A INTRINSIC
low complexity region 3039 3076 N/A INTRINSIC
low complexity region 3091 3103 N/A INTRINSIC
FN3 3104 3183 4.6e-1 SMART
KU 3226 3279 4.34e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000097653
AA Change: S1857P
SMART Domains Protein: ENSMUSP00000137585
Gene: ENSMUSG00000048126
AA Change: S1857P

DomainStartEndE-ValueType
VWA 35 210 7.27e-43 SMART
VWA 227 403 4.21e-39 SMART
VWA 417 596 3.02e-40 SMART
VWA 621 799 1.1e-42 SMART
VWA 824 997 9.17e-40 SMART
VWA 1027 1200 1.78e-37 SMART
VWA 1226 1415 7.92e-3 SMART
Pfam:Collagen 1426 1486 9.2e-10 PFAM
Pfam:Collagen 1473 1539 2.2e-9 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 3.95e-21 SMART
VWA 2007 2206 2.25e-25 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 4.6e-1 SMART
KU 2619 2672 4.34e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000188587
AA Change: S1857P
SMART Domains Protein: ENSMUSP00000140858
Gene: ENSMUSG00000048126
AA Change: S1857P

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWA 35 210 4.7e-45 SMART
VWA 227 403 2.7e-41 SMART
VWA 417 596 2e-42 SMART
VWA 621 799 7e-45 SMART
VWA 824 997 5.8e-42 SMART
VWA 1027 1200 1.1e-39 SMART
VWA 1226 1415 4.8e-5 SMART
Pfam:Collagen 1426 1486 3.8e-8 PFAM
Pfam:Collagen 1473 1539 9.1e-8 PFAM
low complexity region 1572 1615 N/A INTRINSIC
low complexity region 1621 1672 N/A INTRINSIC
low complexity region 1690 1704 N/A INTRINSIC
low complexity region 1713 1734 N/A INTRINSIC
VWA 1790 1969 2.4e-23 SMART
VWA 2007 2206 1.4e-27 SMART
low complexity region 2257 2273 N/A INTRINSIC
low complexity region 2279 2293 N/A INTRINSIC
low complexity region 2296 2334 N/A INTRINSIC
low complexity region 2338 2417 N/A INTRINSIC
low complexity region 2432 2469 N/A INTRINSIC
low complexity region 2484 2496 N/A INTRINSIC
FN3 2497 2576 2.2e-3 SMART
KU 2619 2672 2.1e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha-3 chain, one of the three alpha chains of type VI collagen, a beaded filament collagen found in most connective tissues. The alpha-3 chain of type VI collagen is much larger than the alpha-1 and -2 chains. This difference in size is largely due to an increase in the number of subdomains, similar to von Willebrand Factor type A domains, that are found in the amino terminal globular domain of all the alpha chains. These domains have been shown to bind extracellular matrix proteins, an interaction that explains the importance of this collagen in organizing matrix components. Mutations in the type VI collagen genes are associated with Bethlem myopathy, a rare autosomal dominant proximal myopathy with early childhood onset. Mutations in this gene are also a cause of Ullrich congenital muscular dystrophy, also referred to as Ullrich scleroatonic muscular dystrophy, an autosomal recessive congenital myopathy that is more severe than Bethlem myopathy. Multiple transcript variants have been identified, but the full-length nature of only some of these variants has been described. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit mild myopathy, decreased skeletal muscle weight, increased collagen deposition in muscles, skeletal muscle interstitial fibrosis and abnormal tendon collagen fibril morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Col6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Col6a3 APN 1 90828255 missense probably damaging 1.00
IGL00425:Col6a3 APN 1 90782026 missense unknown
IGL00541:Col6a3 APN 1 90802142 missense possibly damaging 0.83
IGL01063:Col6a3 APN 1 90802332 missense probably damaging 1.00
IGL01094:Col6a3 APN 1 90803933 missense possibly damaging 0.93
IGL01138:Col6a3 APN 1 90807510 missense probably damaging 1.00
IGL01291:Col6a3 APN 1 90802292 missense probably damaging 1.00
IGL01674:Col6a3 APN 1 90802514 missense probably damaging 1.00
IGL01756:Col6a3 APN 1 90779162 missense unknown
IGL01827:Col6a3 APN 1 90802319 missense probably damaging 1.00
IGL01845:Col6a3 APN 1 90796571 missense probably damaging 1.00
IGL01869:Col6a3 APN 1 90773048 missense unknown
IGL01900:Col6a3 APN 1 90795010 critical splice donor site probably null
IGL01925:Col6a3 APN 1 90802236 missense possibly damaging 0.95
IGL02002:Col6a3 APN 1 90782136 splice site probably benign
IGL02115:Col6a3 APN 1 90807651 missense probably damaging 0.99
IGL02302:Col6a3 APN 1 90781760 missense unknown
IGL02313:Col6a3 APN 1 90811606 missense probably damaging 1.00
IGL02458:Col6a3 APN 1 90779197 missense unknown
IGL02821:Col6a3 APN 1 90803878 missense probably damaging 1.00
IGL02828:Col6a3 APN 1 90796559 missense probably damaging 1.00
IGL03112:Col6a3 APN 1 90811520 nonsense probably null
IGL03129:Col6a3 APN 1 90821862 missense probably damaging 1.00
IGL03132:Col6a3 APN 1 90803893 missense probably damaging 1.00
IGL03148:Col6a3 APN 1 90827866 missense probably benign 0.33
IGL03251:Col6a3 APN 1 90810176 missense probably damaging 1.00
ANU05:Col6a3 UTSW 1 90802292 missense probably damaging 1.00
IGL03048:Col6a3 UTSW 1 90810248 missense possibly damaging 0.58
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0020:Col6a3 UTSW 1 90811550 missense probably damaging 0.99
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0033:Col6a3 UTSW 1 90802245 missense probably damaging 1.00
R0105:Col6a3 UTSW 1 90798161 missense possibly damaging 0.65
R0116:Col6a3 UTSW 1 90813551 missense probably damaging 1.00
R0167:Col6a3 UTSW 1 90798173 missense probably damaging 1.00
R0319:Col6a3 UTSW 1 90807704 missense possibly damaging 0.95
R0348:Col6a3 UTSW 1 90828049 missense probably damaging 1.00
R0365:Col6a3 UTSW 1 90788216 missense unknown
R0512:Col6a3 UTSW 1 90821798 intron probably benign
R0564:Col6a3 UTSW 1 90807734 missense probably damaging 1.00
R0635:Col6a3 UTSW 1 90808086 splice site probably null
R0667:Col6a3 UTSW 1 90828101 missense probably damaging 0.98
R0680:Col6a3 UTSW 1 90778981 missense unknown
R0736:Col6a3 UTSW 1 90804089 missense possibly damaging 0.95
R0737:Col6a3 UTSW 1 90828298 missense probably damaging 1.00
R0747:Col6a3 UTSW 1 90802653 missense probably damaging 1.00
R1155:Col6a3 UTSW 1 90794325 missense probably null 1.00
R1169:Col6a3 UTSW 1 90822014 missense possibly damaging 0.67
R1180:Col6a3 UTSW 1 90781855 missense unknown
R1225:Col6a3 UTSW 1 90811516 missense probably damaging 1.00
R1343:Col6a3 UTSW 1 90768347 missense unknown
R1387:Col6a3 UTSW 1 90822416 intron probably benign
R1437:Col6a3 UTSW 1 90801376 missense probably damaging 1.00
R1448:Col6a3 UTSW 1 90781855 missense unknown
R1677:Col6a3 UTSW 1 90821861 missense probably benign 0.14
R1681:Col6a3 UTSW 1 90773502 missense unknown
R1711:Col6a3 UTSW 1 90830213 missense probably damaging 1.00
R1727:Col6a3 UTSW 1 90796574 critical splice acceptor site probably null
R1736:Col6a3 UTSW 1 90779059 missense unknown
R1738:Col6a3 UTSW 1 90816361 missense probably damaging 1.00
R1742:Col6a3 UTSW 1 90813794 missense probably damaging 1.00
R1809:Col6a3 UTSW 1 90827949 missense probably damaging 1.00
R1851:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1852:Col6a3 UTSW 1 90807534 missense possibly damaging 0.69
R1872:Col6a3 UTSW 1 90830214 missense probably damaging 0.96
R1889:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1895:Col6a3 UTSW 1 90803711 missense probably benign 0.00
R1908:Col6a3 UTSW 1 90811699 missense probably damaging 1.00
R1919:Col6a3 UTSW 1 90822359 missense possibly damaging 0.66
R1973:Col6a3 UTSW 1 90804175 missense probably damaging 1.00
R2083:Col6a3 UTSW 1 90782011 missense unknown
R2121:Col6a3 UTSW 1 90810365 missense probably damaging 1.00
R2197:Col6a3 UTSW 1 90803745 missense probably benign 0.09
R2448:Col6a3 UTSW 1 90813358 missense probably damaging 1.00
R2831:Col6a3 UTSW 1 90803713 missense possibly damaging 0.89
R2877:Col6a3 UTSW 1 90775599 missense unknown
R3052:Col6a3 UTSW 1 90802130 missense possibly damaging 0.71
R3104:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3105:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3106:Col6a3 UTSW 1 90816302 missense probably damaging 0.99
R3418:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3419:Col6a3 UTSW 1 90804091 missense probably benign 0.42
R3837:Col6a3 UTSW 1 90780081 missense unknown
R4007:Col6a3 UTSW 1 90802569 missense probably damaging 1.00
R4082:Col6a3 UTSW 1 90821883 missense probably damaging 1.00
R4181:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4200:Col6a3 UTSW 1 90801383 missense probably benign 0.28
R4244:Col6a3 UTSW 1 90786639 missense unknown
R4297:Col6a3 UTSW 1 90811378 missense probably damaging 1.00
R4302:Col6a3 UTSW 1 90807614 missense probably damaging 1.00
R4472:Col6a3 UTSW 1 90822014 missense probably benign 0.23
R4683:Col6a3 UTSW 1 90773457 missense unknown
R4788:Col6a3 UTSW 1 90772950 critical splice donor site probably null
R4851:Col6a3 UTSW 1 90779289 missense unknown
R4899:Col6a3 UTSW 1 90802427 missense probably damaging 0.99
R4904:Col6a3 UTSW 1 90801442 missense probably damaging 1.00
R4908:Col6a3 UTSW 1 90807524 missense probably damaging 1.00
R4960:Col6a3 UTSW 1 90804218 missense probably damaging 1.00
R4981:Col6a3 UTSW 1 90778843 missense unknown
R5057:Col6a3 UTSW 1 90816130 missense possibly damaging 0.91
R5062:Col6a3 UTSW 1 90779352 missense unknown
R5105:Col6a3 UTSW 1 90798140 missense possibly damaging 0.81
R5127:Col6a3 UTSW 1 90768345 missense unknown
R5166:Col6a3 UTSW 1 90810608 missense probably damaging 1.00
R5168:Col6a3 UTSW 1 90773639 nonsense probably null
R5196:Col6a3 UTSW 1 90816538 splice site probably null
R5230:Col6a3 UTSW 1 90789054 missense unknown
R5268:Col6a3 UTSW 1 90785243 missense unknown
R5381:Col6a3 UTSW 1 90775612 missense unknown
R5392:Col6a3 UTSW 1 90801295 missense probably benign 0.41
R5445:Col6a3 UTSW 1 90782039 nonsense probably null
R5571:Col6a3 UTSW 1 90788216 missense unknown
R5665:Col6a3 UTSW 1 90827880 missense probably benign 0.00
R5902:Col6a3 UTSW 1 90802199 unclassified probably null
R5914:Col6a3 UTSW 1 90776200 missense unknown
R5955:Col6a3 UTSW 1 90811441 missense probably damaging 1.00
R5977:Col6a3 UTSW 1 90821849 missense possibly damaging 0.82
R6006:Col6a3 UTSW 1 90768383 missense unknown
R6010:Col6a3 UTSW 1 90773497 missense unknown
R6025:Col6a3 UTSW 1 90828102 missense probably damaging 1.00
R6151:Col6a3 UTSW 1 90813753 missense possibly damaging 0.53
R6154:Col6a3 UTSW 1 90773665 missense unknown
R6181:Col6a3 UTSW 1 90816374 missense possibly damaging 0.95
R6197:Col6a3 UTSW 1 90822341 missense probably damaging 1.00
R6332:Col6a3 UTSW 1 90822233 missense probably damaging 1.00
R6362:Col6a3 UTSW 1 90810563 missense probably damaging 0.99
R6476:Col6a3 UTSW 1 90781812 missense unknown
R6484:Col6a3 UTSW 1 90791923 critical splice donor site probably null
R6701:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6702:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90779439 missense unknown
R6703:Col6a3 UTSW 1 90792462 missense probably benign 0.14
R6724:Col6a3 UTSW 1 90779152 missense unknown
R6746:Col6a3 UTSW 1 90779045 missense unknown
R6797:Col6a3 UTSW 1 90804088 missense probably damaging 0.99
R6798:Col6a3 UTSW 1 90795009 splice site probably null
R6903:Col6a3 UTSW 1 90794207 missense probably damaging 1.00
R6925:Col6a3 UTSW 1 90816002 missense probably benign 0.00
R6978:Col6a3 UTSW 1 90807470 critical splice donor site probably null
X0024:Col6a3 UTSW 1 90803637 critical splice donor site probably null
X0063:Col6a3 UTSW 1 90803905 missense probably damaging 1.00
X0067:Col6a3 UTSW 1 90811529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTGAGTACGGCCTCTC -3'
(R):5'- TCCCAACAGAACTCGCCTTTG -3'

Sequencing Primer
(F):5'- TACGGCCTCTCGGAGCTG -3'
(R):5'- TTGCCCTGGATACCTCTGAGG -3'
Posted On2015-09-25