Incidental Mutation 'R4600:Dnhd1'
ID345526
Institutional Source Beutler Lab
Gene Symbol Dnhd1
Ensembl Gene ENSMUSG00000030882
Gene Namedynein heavy chain domain 1
Synonyms8030491N06Rik
Accession Numbers

Variant 1:ENSMUST00000145988; OTTMUST00000062891; Variant 2:  ENSMUST00000106773; Variant 3: ENSMUST00000106776; Variant 4: ENSMUST00000163171; Variant 5: ENSMUST00000142363;OTTMUST00000062869; Variant 6: ENSMUST00000142874; OTTMUST00000062870; Variant 7: ENSMUST00000128388; OTTMUST00000062892; MGI:1924755

Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105650827-105721799 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105703644 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 2668 (R2668L)
Ref Sequence ENSEMBL: ENSMUSP00000121261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000145988]
Predicted Effect probably damaging
Transcript: ENSMUST00000145988
AA Change: R2668L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121261
Gene: ENSMUSG00000030882
AA Change: R2668L

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 943 962 N/A INTRINSIC
Pfam:DHC_N2 1018 1472 4.6e-50 PFAM
Pfam:AAA_6 1652 1875 2.7e-14 PFAM
low complexity region 1906 1918 N/A INTRINSIC
Blast:AAA 1993 2196 1e-34 BLAST
Pfam:AAA_7 2362 2610 3.3e-11 PFAM
low complexity region 2697 2714 N/A INTRINSIC
low complexity region 2722 2733 N/A INTRINSIC
low complexity region 2800 2810 N/A INTRINSIC
low complexity region 3116 3134 N/A INTRINSIC
Pfam:MT 3178 3470 3.9e-16 PFAM
coiled coil region 3590 3642 N/A INTRINSIC
coiled coil region 3816 3843 N/A INTRINSIC
Pfam:Dynein_heavy 3976 4746 7.3e-97 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Dnhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dnhd1 APN 7 105677995 missense probably damaging 1.00
IGL00516:Dnhd1 APN 7 105657211 missense possibly damaging 0.52
IGL00576:Dnhd1 APN 7 105692675 missense probably damaging 1.00
IGL00990:Dnhd1 APN 7 105721688 missense possibly damaging 0.85
IGL01346:Dnhd1 APN 7 105713909 missense probably benign
IGL01714:Dnhd1 APN 7 105720942 missense probably damaging 1.00
IGL01735:Dnhd1 APN 7 105713754 missense probably benign 0.37
IGL01814:Dnhd1 APN 7 105652030 missense probably benign
IGL01999:Dnhd1 APN 7 105721215 missense possibly damaging 0.50
IGL02022:Dnhd1 APN 7 105678309 missense probably damaging 1.00
IGL02131:Dnhd1 APN 7 105720802 missense probably damaging 1.00
IGL02156:Dnhd1 APN 7 105721744 missense probably damaging 1.00
IGL02674:Dnhd1 APN 7 105721481 missense probably benign 0.00
IGL02966:Dnhd1 APN 7 105720741 missense probably benign 0.00
IGL03066:Dnhd1 APN 7 105719882 missense probably damaging 0.99
IGL03298:Dnhd1 APN 7 105714475 missense probably damaging 0.98
IGL03378:Dnhd1 APN 7 105713733 missense possibly damaging 0.87
IGL02802:Dnhd1 UTSW 7 105655723 missense possibly damaging 0.83
R0060:Dnhd1 UTSW 7 105668514 missense probably damaging 0.99
R0129:Dnhd1 UTSW 7 105720924 missense probably benign 0.19
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0238:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0239:Dnhd1 UTSW 7 105721531 missense probably benign 0.06
R0384:Dnhd1 UTSW 7 105720114 missense possibly damaging 0.56
R0453:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R0540:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0554:Dnhd1 UTSW 7 105694395 missense probably benign 0.10
R0576:Dnhd1 UTSW 7 105714045 missense probably damaging 1.00
R0607:Dnhd1 UTSW 7 105720788 missense probably benign 0.04
R0631:Dnhd1 UTSW 7 105651624 missense probably benign 0.17
R0639:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0668:Dnhd1 UTSW 7 105695751 missense probably benign
R0669:Dnhd1 UTSW 7 105693704 missense probably benign 0.01
R0670:Dnhd1 UTSW 7 105696464 missense possibly damaging 0.95
R0699:Dnhd1 UTSW 7 105651906 missense probably damaging 0.98
R1019:Dnhd1 UTSW 7 105709171 missense probably damaging 1.00
R1144:Dnhd1 UTSW 7 105713031 missense probably damaging 1.00
R1226:Dnhd1 UTSW 7 105696899 missense probably damaging 1.00
R1257:Dnhd1 UTSW 7 105694153 missense probably damaging 1.00
R1391:Dnhd1 UTSW 7 105720124 missense probably damaging 1.00
R1453:Dnhd1 UTSW 7 105721273 critical splice donor site probably null
R1501:Dnhd1 UTSW 7 105668463 missense probably benign 0.00
R1503:Dnhd1 UTSW 7 105693660 missense possibly damaging 0.67
R1515:Dnhd1 UTSW 7 105704148 missense probably benign 0.11
R1615:Dnhd1 UTSW 7 105703206 missense probably benign 0.00
R1615:Dnhd1 UTSW 7 105713706 missense possibly damaging 0.74
R1656:Dnhd1 UTSW 7 105714281 missense probably damaging 1.00
R1720:Dnhd1 UTSW 7 105693828 missense probably benign
R1723:Dnhd1 UTSW 7 105714920 missense possibly damaging 0.60
R1766:Dnhd1 UTSW 7 105693972 missense possibly damaging 0.50
R1799:Dnhd1 UTSW 7 105655767 missense probably benign 0.31
R1860:Dnhd1 UTSW 7 105704205 missense probably benign
R1920:Dnhd1 UTSW 7 105713407 missense probably benign 0.00
R1925:Dnhd1 UTSW 7 105652252 missense probably damaging 1.00
R1925:Dnhd1 UTSW 7 105673854 missense probably damaging 0.96
R1934:Dnhd1 UTSW 7 105708582 missense probably benign 0.05
R1935:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R1936:Dnhd1 UTSW 7 105673976 missense probably benign 0.09
R2035:Dnhd1 UTSW 7 105704921 missense probably damaging 0.99
R2125:Dnhd1 UTSW 7 105677971 missense probably benign 0.35
R2127:Dnhd1 UTSW 7 105693721 missense possibly damaging 0.56
R2254:Dnhd1 UTSW 7 105703772 missense probably damaging 1.00
R2301:Dnhd1 UTSW 7 105705399 missense probably damaging 1.00
R2316:Dnhd1 UTSW 7 105674421 missense probably damaging 1.00
R2324:Dnhd1 UTSW 7 105710090 missense probably damaging 1.00
R2337:Dnhd1 UTSW 7 105703467 missense probably benign 0.07
R2381:Dnhd1 UTSW 7 105693664 missense probably benign 0.42
R2394:Dnhd1 UTSW 7 105720231 missense probably benign 0.19
R2862:Dnhd1 UTSW 7 105712559 missense probably benign 0.01
R3038:Dnhd1 UTSW 7 105720229 missense probably damaging 0.99
R3114:Dnhd1 UTSW 7 105696565 critical splice donor site probably null
R3404:Dnhd1 UTSW 7 105694761 nonsense probably null
R3405:Dnhd1 UTSW 7 105694761 nonsense probably null
R3439:Dnhd1 UTSW 7 105694785 missense probably damaging 1.00
R3959:Dnhd1 UTSW 7 105713122 missense probably benign 0.21
R4014:Dnhd1 UTSW 7 105714838 missense probably damaging 0.99
R4084:Dnhd1 UTSW 7 105709588 missense probably damaging 1.00
R4181:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4255:Dnhd1 UTSW 7 105712998 missense probably damaging 1.00
R4302:Dnhd1 UTSW 7 105693954 missense probably damaging 1.00
R4440:Dnhd1 UTSW 7 105696728 nonsense probably null
R4565:Dnhd1 UTSW 7 105651956 missense possibly damaging 0.92
R4569:Dnhd1 UTSW 7 105657166 splice site probably null
R4584:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4586:Dnhd1 UTSW 7 105678049 missense probably damaging 1.00
R4590:Dnhd1 UTSW 7 105714030 missense probably damaging 1.00
R4593:Dnhd1 UTSW 7 105715446 missense probably benign 0.02
R4705:Dnhd1 UTSW 7 105655741 missense probably damaging 1.00
R4731:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4732:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4733:Dnhd1 UTSW 7 105673849 missense probably benign 0.00
R4786:Dnhd1 UTSW 7 105674444 missense probably benign 0.00
R4791:Dnhd1 UTSW 7 105721117 missense probably damaging 1.00
R4811:Dnhd1 UTSW 7 105714281 missense probably damaging 0.99
R4822:Dnhd1 UTSW 7 105703964 missense probably benign 0.00
R4886:Dnhd1 UTSW 7 105714808 missense probably benign 0.00
R4890:Dnhd1 UTSW 7 105656957 missense possibly damaging 0.47
R4973:Dnhd1 UTSW 7 105713633 missense probably benign 0.24
R5007:Dnhd1 UTSW 7 105713076 missense probably damaging 1.00
R5048:Dnhd1 UTSW 7 105693697 missense probably benign 0.01
R5151:Dnhd1 UTSW 7 105713440 missense probably benign 0.22
R5179:Dnhd1 UTSW 7 105714552 missense probably damaging 1.00
R5182:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5183:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5185:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5209:Dnhd1 UTSW 7 105696460 missense probably benign 0.00
R5225:Dnhd1 UTSW 7 105703923 missense possibly damaging 0.73
R5250:Dnhd1 UTSW 7 105685761 missense probably damaging 1.00
R5257:Dnhd1 UTSW 7 105674037 missense probably benign
R5258:Dnhd1 UTSW 7 105674037 missense probably benign
R5273:Dnhd1 UTSW 7 105714482 missense probably damaging 0.99
R5288:Dnhd1 UTSW 7 105714437 missense possibly damaging 0.94
R5396:Dnhd1 UTSW 7 105713684 missense probably benign 0.00
R5453:Dnhd1 UTSW 7 105710123 missense probably damaging 1.00
R5511:Dnhd1 UTSW 7 105714156 missense probably damaging 1.00
R5518:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5523:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5528:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5529:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5561:Dnhd1 UTSW 7 105714821 missense probably damaging 0.99
R5681:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5682:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5683:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5684:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5686:Dnhd1 UTSW 7 105703209 missense probably damaging 1.00
R5697:Dnhd1 UTSW 7 105674188 missense probably damaging 1.00
R5789:Dnhd1 UTSW 7 105705010 missense possibly damaging 0.50
R5790:Dnhd1 UTSW 7 105655774 missense probably damaging 1.00
R5814:Dnhd1 UTSW 7 105719895 missense possibly damaging 0.69
R5828:Dnhd1 UTSW 7 105720181 missense probably benign 0.00
R5852:Dnhd1 UTSW 7 105695748 missense probably damaging 1.00
R5883:Dnhd1 UTSW 7 105720504 missense probably damaging 0.98
R6115:Dnhd1 UTSW 7 105713987 missense probably benign 0.00
R6119:Dnhd1 UTSW 7 105709440 missense probably benign 0.18
R6212:Dnhd1 UTSW 7 105704048 missense probably damaging 1.00
R6243:Dnhd1 UTSW 7 105652009 missense probably damaging 1.00
R6265:Dnhd1 UTSW 7 105693370 missense probably benign 0.07
R6332:Dnhd1 UTSW 7 105694066 missense probably benign 0.02
R6344:Dnhd1 UTSW 7 105694610 missense probably benign 0.38
R6477:Dnhd1 UTSW 7 105677886 missense probably benign 0.05
R6642:Dnhd1 UTSW 7 105703799 missense probably benign
R6663:Dnhd1 UTSW 7 105685692 intron probably null
R6730:Dnhd1 UTSW 7 105703875 missense probably benign 0.00
R6748:Dnhd1 UTSW 7 105720637 missense probably benign 0.03
R6833:Dnhd1 UTSW 7 105703373 missense probably benign 0.01
R6850:Dnhd1 UTSW 7 105719930 missense possibly damaging 0.68
R6853:Dnhd1 UTSW 7 105703728 missense probably benign
R6860:Dnhd1 UTSW 7 105678266 missense probably benign
R6898:Dnhd1 UTSW 7 105687377 missense probably damaging 0.99
R6927:Dnhd1 UTSW 7 105715563 missense probably damaging 1.00
R6952:Dnhd1 UTSW 7 105713688 missense probably damaging 1.00
R6987:Dnhd1 UTSW 7 105704585 missense probably damaging 0.98
R6988:Dnhd1 UTSW 7 105714210 missense probably damaging 1.00
R7022:Dnhd1 UTSW 7 105720798 missense probably benign 0.36
R7053:Dnhd1 UTSW 7 105694954 missense probably damaging 1.00
R7085:Dnhd1 UTSW 7 105715261 missense not run
R7086:Dnhd1 UTSW 7 105708532 missense not run
R7112:Dnhd1 UTSW 7 105713985 missense not run
R7140:Dnhd1 UTSW 7 105693766 missense not run
R7151:Dnhd1 UTSW 7 105710027 missense not run
Z1088:Dnhd1 UTSW 7 105712727 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTGCCTACCAGAATG -3'
(R):5'- CCTGAAGGCCATATGGATCCTC -3'

Sequencing Primer
(F):5'- TGCCTACCAGAATGGGTTCAC -3'
(R):5'- TGATCCACTGTCACTGTTGCTTAAG -3'
Posted On2015-09-25