Incidental Mutation 'R4600:Itgb2'
ID345545
Institutional Source Beutler Lab
Gene Symbol Itgb2
Ensembl Gene ENSMUSG00000000290
Gene Nameintegrin beta 2
SynonymsMac-1 beta, Cd18, 2E6
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location77530252-77565708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77546115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 84 (I84V)
Ref Sequence ENSEMBL: ENSMUSP00000137734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000299] [ENSMUST00000130059] [ENSMUST00000131023] [ENSMUST00000153541] [ENSMUST00000156644]
Predicted Effect probably benign
Transcript: ENSMUST00000000299
AA Change: I84V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000299
Gene: ENSMUSG00000000290
AA Change: I84V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
internal_repeat_1 459 509 7.99e-5 PROSPERO
EGF_like 535 574 6.81e1 SMART
Integrin_B_tail 622 701 5.53e-22 SMART
transmembrane domain 702 724 N/A INTRINSIC
Integrin_b_cyt 725 770 1.58e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130059
AA Change: I6V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118191
Gene: ENSMUSG00000000290
AA Change: I6V

DomainStartEndE-ValueType
INB 1 130 2.21e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131023
AA Change: I6V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119657
Gene: ENSMUSG00000000290
AA Change: I6V

DomainStartEndE-ValueType
Pfam:Integrin_beta 2 54 7.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153541
AA Change: I84V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137734
Gene: ENSMUSG00000000290
AA Change: I84V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PSI 24 74 6.91e-7 SMART
INB 32 447 1.98e-268 SMART
VWA 126 357 1.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156644
SMART Domains Protein: ENSMUSP00000137865
Gene: ENSMUSG00000000290

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:2P28|A 23 49 9e-12 PDB
Blast:PSI 24 49 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integrin beta chain, which combines with multiple different alpha chains to form different integrin heterodimers. Integrins are integral cell-surface proteins that participate in cell adhesion as well as cell-surface mediated signalling. The encoded protein plays an important role in immune response and defects in this gene cause leukocyte adhesion deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for targeted null and hypomorphic mutations are subject to granulocytosis, impaired inflammatory and immune responses, and chronic dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Itgb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Itgb2 APN 10 77557406 missense probably damaging 1.00
IGL00427:Itgb2 APN 10 77557956 missense probably benign 0.13
IGL00500:Itgb2 APN 10 77564724 missense probably damaging 1.00
IGL01019:Itgb2 APN 10 77542403 missense possibly damaging 0.94
IGL01104:Itgb2 APN 10 77547194 splice site probably null
IGL01111:Itgb2 APN 10 77542000 missense probably damaging 0.98
IGL01574:Itgb2 APN 10 77557964 missense possibly damaging 0.82
IGL02087:Itgb2 APN 10 77559696 missense possibly damaging 0.94
IGL02132:Itgb2 APN 10 77550061 missense probably damaging 1.00
IGL02325:Itgb2 APN 10 77547192 missense probably damaging 1.00
IGL02505:Itgb2 APN 10 77547218 missense probably damaging 1.00
IGL02590:Itgb2 APN 10 77559513 missense probably damaging 1.00
IGL02735:Itgb2 APN 10 77549999 missense possibly damaging 0.81
barely UTSW 10 77548536 splice site probably benign
joker UTSW 10 77549849 intron probably benign
newhome UTSW 10 77559681 missense probably benign 0.00
nibbler UTSW 10 77561216 critical splice donor site probably null
Only_just UTSW 10 77549968 missense possibly damaging 0.80
R0217:Itgb2 UTSW 10 77548536 splice site probably benign
R0394:Itgb2 UTSW 10 77542475 missense probably damaging 1.00
R0396:Itgb2 UTSW 10 77561189 missense probably damaging 0.97
R1425:Itgb2 UTSW 10 77547296 missense probably null 1.00
R1499:Itgb2 UTSW 10 77546153 missense possibly damaging 0.62
R1542:Itgb2 UTSW 10 77559486 missense probably benign
R1803:Itgb2 UTSW 10 77564790 missense probably benign 0.15
R1889:Itgb2 UTSW 10 77548623 missense possibly damaging 0.74
R2035:Itgb2 UTSW 10 77547199 missense probably damaging 1.00
R2156:Itgb2 UTSW 10 77560248 missense probably benign 0.01
R2374:Itgb2 UTSW 10 77559681 missense probably benign 0.00
R3769:Itgb2 UTSW 10 77549968 missense possibly damaging 0.80
R3942:Itgb2 UTSW 10 77558033 missense probably benign 0.31
R4352:Itgb2 UTSW 10 77556167 missense probably benign 0.10
R4537:Itgb2 UTSW 10 77561216 critical splice donor site probably null
R4611:Itgb2 UTSW 10 77550050 missense probably damaging 1.00
R4685:Itgb2 UTSW 10 77550103 critical splice donor site probably null
R4717:Itgb2 UTSW 10 77546044 nonsense probably null
R5068:Itgb2 UTSW 10 77548761 missense probably damaging 1.00
R5297:Itgb2 UTSW 10 77564667 missense probably damaging 1.00
R5355:Itgb2 UTSW 10 77558052 missense probably benign
R5927:Itgb2 UTSW 10 77546034 missense probably damaging 1.00
R6371:Itgb2 UTSW 10 77548597 missense probably damaging 1.00
R6505:Itgb2 UTSW 10 77559673 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACTTTCAAGGGCAGGTAAG -3'
(R):5'- ACCTCGCAGTTGCATCTCAC -3'

Sequencing Primer
(F):5'- GAAGGAAACAGGGCTGGATCCC -3'
(R):5'- CCTGGTCGCAAGTAAAGT -3'
Posted On2015-09-25