Incidental Mutation 'R4600:Ndufs7'
ID345546
Institutional Source Beutler Lab
Gene Symbol Ndufs7
Ensembl Gene ENSMUSG00000020153
Gene NameNADH dehydrogenase (ubiquinone) Fe-S protein 7
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80249121-80256794 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 80256667 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 203 (Y203*)
Ref Sequence ENSEMBL: ENSMUSP00000101003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020359] [ENSMUST00000020361] [ENSMUST00000105363] [ENSMUST00000105364] [ENSMUST00000156935]
Predicted Effect probably benign
Transcript: ENSMUST00000020359
SMART Domains Protein: ENSMUSP00000020359
Gene: ENSMUSG00000020150

DomainStartEndE-ValueType
PDB:1XCL|A 2 252 1e-151 PDB
SCOP:d1khha_ 44 252 3e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000020361
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000020361
Gene: ENSMUSG00000020153
AA Change: Y203*

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105363
SMART Domains Protein: ENSMUSP00000101002
Gene: ENSMUSG00000020150

DomainStartEndE-ValueType
PDB:1XCL|A 2 236 1e-155 PDB
SCOP:d1khha_ 44 236 2e-34 SMART
Predicted Effect probably null
Transcript: ENSMUST00000105364
AA Change: Y203*
SMART Domains Protein: ENSMUSP00000101003
Gene: ENSMUSG00000020153
AA Change: Y203*

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
Pfam:Oxidored_q6 98 208 1.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155336
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155523
Predicted Effect probably benign
Transcript: ENSMUST00000156935
SMART Domains Protein: ENSMUSP00000117497
Gene: ENSMUSG00000069565

DomainStartEndE-ValueType
RRM 3 75 1.89e-24 SMART
RRM 105 171 6.71e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157063
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a subunit of one of the complexes that forms the mitochondrial respiratory chain. This protein is one of over 40 subunits found in complex I, the nicotinamide adenine dinucleotide (NADH):ubiquinone oxidoreductase. This complex functions in the transfer of electrons from NADH to the respiratory chain, and ubiquinone is believed to be the immediate electron acceptor for the enzyme. Mutations in this gene cause Leigh syndrome due to mitochondrial complex I deficiency, a severe neurological disorder that results in bilaterally symmetrical necrotic lesions in subcortical brain regions. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Nup160 T A 2: 90,685,197 probably null Het
Nup88 G A 11: 70,969,696 R62* probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Ndufs7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Ndufs7 APN 10 80256005 nonsense probably null
IGL00940:Ndufs7 APN 10 80255121 missense probably damaging 0.98
R0539:Ndufs7 UTSW 10 80254831 splice site probably benign
R1727:Ndufs7 UTSW 10 80256019 splice site probably benign
R3714:Ndufs7 UTSW 10 80252421 missense probably benign 0.00
R4603:Ndufs7 UTSW 10 80256667 nonsense probably null
R5437:Ndufs7 UTSW 10 80254924 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- CTTTTCCCTGTGGAGCCATG -3'
(R):5'- TCAAGAGCCAGGAGTGATCAC -3'

Sequencing Primer
(F):5'- CCATGGACAGCTCAGGGATG -3'
(R):5'- CACAGAGGGTGCAGGACCTG -3'
Posted On2015-09-25