Incidental Mutation 'R4600:Nup88'
ID345552
Institutional Source Beutler Lab
Gene Symbol Nup88
Ensembl Gene ENSMUSG00000040667
Gene Namenucleoporin 88
SynonymsNup84, Prei2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R4600 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70943058-70969973 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 70969696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 62 (R62*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018593] [ENSMUST00000035283] [ENSMUST00000108529] [ENSMUST00000108530] [ENSMUST00000108531] [ENSMUST00000154430] [ENSMUST00000167509] [ENSMUST00000169965] [ENSMUST00000171254] [ENSMUST00000178822]
Predicted Effect probably benign
Transcript: ENSMUST00000018593
SMART Domains Protein: ENSMUSP00000018593
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 8 47 1.7e-21 PFAM
Pfam:RPA_interact_M 59 127 1.1e-14 PFAM
Pfam:RPA_interact_C 136 217 2.8e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000035283
AA Change: R86*
SMART Domains Protein: ENSMUSP00000048101
Gene: ENSMUSG00000040667
AA Change: R86*

DomainStartEndE-ValueType
Pfam:Nup88 13 752 1.1e-306 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108529
SMART Domains Protein: ENSMUSP00000104169
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 7.6e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108530
AA Change: R86*
SMART Domains Protein: ENSMUSP00000104170
Gene: ENSMUSG00000040667
AA Change: R86*

DomainStartEndE-ValueType
Pfam:Nup88 11 742 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000108531
AA Change: R86*
SMART Domains Protein: ENSMUSP00000104171
Gene: ENSMUSG00000040667
AA Change: R86*

DomainStartEndE-ValueType
Pfam:Nup88 11 747 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129531
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151608
Predicted Effect probably benign
Transcript: ENSMUST00000154430
SMART Domains Protein: ENSMUSP00000137113
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 38 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167509
SMART Domains Protein: ENSMUSP00000127315
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169965
SMART Domains Protein: ENSMUSP00000128903
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1e-23 PFAM
Pfam:RPA_interact_M 58 106 6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171254
SMART Domains Protein: ENSMUSP00000133243
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 1.1e-23 PFAM
Pfam:RPA_interact_M 58 107 3.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000178253
AA Change: R62*
Predicted Effect probably benign
Transcript: ENSMUST00000178822
SMART Domains Protein: ENSMUSP00000136592
Gene: ENSMUSG00000018449

DomainStartEndE-ValueType
Pfam:RPA_interact_N 7 48 2.7e-23 PFAM
Pfam:RPA_interact_M 58 128 5.3e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins, a family of 50 to 100 proteins, are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene belongs to the nucleoporin family and is associated with the oncogenic nucleoporin CAN/Nup214 in a dynamic subcomplex. This protein is also overexpressed in a large number of malignant neoplasms and precancerous dysplasias. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
2700049A03Rik T C 12: 71,148,263 F145L possibly damaging Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Ago1 C A 4: 126,460,392 M208I probably benign Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Amfr A G 8: 93,974,221 L537P probably damaging Het
Apob A G 12: 8,008,568 D2317G probably damaging Het
Asb6 T A 2: 30,824,471 D209V probably damaging Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Baz2a T A 10: 128,121,183 C932S probably damaging Het
BC067074 A G 13: 113,319,249 R610G possibly damaging Het
Btnl10 A G 11: 58,923,600 I369V probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Clic4 A T 4: 135,238,989 probably null Het
Col6a3 A G 1: 90,781,904 S1857P unknown Het
Cracr2a A C 6: 127,603,888 D9A probably benign Het
Dcst1 T C 3: 89,356,336 E384G probably benign Het
Ddx4 T C 13: 112,612,060 K435E probably damaging Het
Deaf1 T A 7: 141,310,971 T433S possibly damaging Het
Dnah3 T A 7: 120,089,946 M82L probably benign Het
Dnhd1 G T 7: 105,703,644 R2668L probably damaging Het
Efcab6 C T 15: 83,946,925 G596D probably benign Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Fam181b C A 7: 93,080,784 A255E possibly damaging Het
Fam83e T A 7: 45,723,500 D178E probably benign Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gm16494 T A 17: 47,016,797 K54* probably null Het
Golgb1 A G 16: 36,918,625 D2442G probably damaging Het
Greb1l G A 18: 10,553,705 A1569T probably damaging Het
Grik5 C G 7: 25,068,064 E64Q probably damaging Het
Gstm5 A G 3: 107,897,986 Y130C probably damaging Het
Gucy2e C G 11: 69,236,168 A160P possibly damaging Het
Hydin A T 8: 110,566,950 T3510S probably benign Het
Itgb2 A G 10: 77,546,115 I84V probably benign Het
Itsn1 A G 16: 91,899,587 Q26R probably damaging Het
Kat6a A G 8: 22,939,311 S1561G probably benign Het
Khnyn G A 14: 55,886,981 V231I probably benign Het
Kif21b A G 1: 136,147,864 D243G probably benign Het
Klk4 T A 7: 43,885,338 N240K probably damaging Het
Knl1 T C 2: 119,070,544 S909P possibly damaging Het
Lamb1 A C 12: 31,323,529 D1419A probably benign Het
Lin9 T A 1: 180,681,194 V421D probably damaging Het
Lipt2 T C 7: 100,160,312 L202P probably benign Het
Mbd5 T G 2: 49,257,197 M473R probably benign Het
Mcc A T 18: 44,519,520 I279N probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mylk2 G A 2: 152,917,556 V389M probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nup160 T A 2: 90,685,197 probably null Het
Olfr130 T C 17: 38,067,962 S264P probably damaging Het
Olfr145 T A 9: 37,898,326 S307R probably benign Het
Olfr609 T A 7: 103,492,581 Q99L probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Olfr952 A G 9: 39,426,435 M212T probably benign Het
Os9 T C 10: 127,098,354 N471S probably benign Het
Otof C T 5: 30,371,900 V1757M probably damaging Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Palm2 A T 4: 57,709,954 T300S probably benign Het
Pappa2 G A 1: 158,814,445 S1347L probably damaging Het
Pccb T C 9: 101,034,779 T27A probably benign Het
Pde4dip A T 3: 97,695,944 V2243D probably damaging Het
Pkd2l2 C A 18: 34,438,201 Q590K probably benign Het
Pmepa1 G A 2: 173,228,327 P145L possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Slc46a2 C T 4: 59,911,886 C442Y probably damaging Het
Slc7a1 A G 5: 148,342,059 L301P probably damaging Het
Spg21 A G 9: 65,475,975 T148A probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Sult1c1 C A 17: 53,973,955 W40L probably benign Het
Sytl2 T C 7: 90,375,769 S322P probably benign Het
Telo2 C A 17: 25,105,148 R531L possibly damaging Het
Thbs3 T C 3: 89,224,590 V719A probably damaging Het
Tlr9 T A 9: 106,224,533 L341Q probably damaging Het
Tmprss5 A G 9: 49,113,248 N230D possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tpo C T 12: 30,098,229 V558M probably benign Het
Trex1 T G 9: 109,058,284 Q213P possibly damaging Het
Ttc30a1 T C 2: 75,980,633 T369A probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Ugt1a6a A G 1: 88,138,864 K131E probably benign Het
Vipr1 T A 9: 121,665,136 probably null Het
Vmn1r22 T C 6: 57,900,875 D39G probably damaging Het
Vmn2r58 A T 7: 41,872,622 C17S probably benign Het
Vps41 T C 13: 18,745,283 Y63H probably damaging Het
Xdh G T 17: 73,910,200 T691N probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Zfp536 T A 7: 37,568,493 K499N probably damaging Het
Zfp963 A T 8: 69,742,860 probably null Het
Other mutations in Nup88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02081:Nup88 APN 11 70954654 splice site probably benign
IGL02219:Nup88 APN 11 70969692 missense probably benign 0.45
IGL02433:Nup88 APN 11 70969888 missense probably benign 0.13
IGL02666:Nup88 APN 11 70943869 intron probably benign
IGL02669:Nup88 APN 11 70956284 missense probably damaging 0.99
IGL02951:Nup88 APN 11 70944872 missense possibly damaging 0.94
unholy UTSW 11 70956192 missense probably damaging 1.00
PIT4515001:Nup88 UTSW 11 70944721 missense probably benign 0.00
R0445:Nup88 UTSW 11 70947729 missense probably benign 0.44
R0737:Nup88 UTSW 11 70969950 start codon destroyed probably null 0.90
R0920:Nup88 UTSW 11 70956320 missense possibly damaging 0.80
R1337:Nup88 UTSW 11 70944890 missense probably damaging 1.00
R2208:Nup88 UTSW 11 70965719 missense probably damaging 1.00
R3735:Nup88 UTSW 11 70956192 missense probably damaging 1.00
R4577:Nup88 UTSW 11 70969717 missense probably damaging 0.96
R4663:Nup88 UTSW 11 70965846 splice site probably null
R4812:Nup88 UTSW 11 70965726 missense probably damaging 1.00
R4824:Nup88 UTSW 11 70961624 missense probably benign 0.10
R5333:Nup88 UTSW 11 70945016 intron probably benign
R5338:Nup88 UTSW 11 70944908 missense probably damaging 0.98
R5443:Nup88 UTSW 11 70958430 nonsense probably null
R5605:Nup88 UTSW 11 70944070 intron probably benign
R5869:Nup88 UTSW 11 70969671 missense probably benign 0.01
R6287:Nup88 UTSW 11 70965755 missense probably benign 0.39
R6364:Nup88 UTSW 11 70947786 missense probably benign
R6409:Nup88 UTSW 11 70944972 missense probably null 0.71
R6555:Nup88 UTSW 11 70944180 missense possibly damaging 0.62
R7203:Nup88 UTSW 11 70945254 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ATATTACGGAGCTTGTGCATGC -3'
(R):5'- GGCGTAAGAAACCAGAGTCC -3'

Sequencing Primer
(F):5'- CTGGGCTACATAGTGATTCCAGAC -3'
(R):5'- GTAAGAAACCAGAGTCCAGCCG -3'
Posted On2015-09-25