Incidental Mutation 'R4601:Cfap126'
ID345594
Institutional Source Beutler Lab
Gene Symbol Cfap126
Ensembl Gene ENSMUSG00000026649
Gene Namecilia and flagella associated protein 126
Synonyms1700009P17Rik, Fltp, Flattop
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4601 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171113918-171126967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 171114058 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 41 (G41C)
Ref Sequence ENSEMBL: ENSMUSP00000114967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129651] [ENSMUST00000151340]
Predicted Effect possibly damaging
Transcript: ENSMUST00000129651
AA Change: G41C

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114967
Gene: ENSMUSG00000026649
AA Change: G41C

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151340
SMART Domains Protein: ENSMUSP00000123188
Gene: ENSMUSG00000026649

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-in allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dgkb T C 12: 38,602,820 S735P probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam160a1 T C 3: 85,741,180 M26V probably damaging Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gif A C 19: 11,752,190 D171A probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Cfap126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01732:Cfap126 APN 1 171126736 missense possibly damaging 0.46
PIT4514001:Cfap126 UTSW 1 171125312 missense probably damaging 1.00
R0014:Cfap126 UTSW 1 171125784 missense possibly damaging 0.55
R0466:Cfap126 UTSW 1 171126200 missense probably damaging 1.00
R1496:Cfap126 UTSW 1 171125817 utr 3 prime probably benign
R2317:Cfap126 UTSW 1 171126131 missense possibly damaging 0.82
R3684:Cfap126 UTSW 1 171114031 missense possibly damaging 0.83
R5960:Cfap126 UTSW 1 171125313 missense probably damaging 1.00
R6717:Cfap126 UTSW 1 171114102 splice site probably null
R6999:Cfap126 UTSW 1 171126164 missense possibly damaging 0.92
X0065:Cfap126 UTSW 1 171126739 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CGTAGTAGTGGTTTCTCAGACAAG -3'
(R):5'- AAGTACCCATTTCCCTTGCG -3'

Sequencing Primer
(F):5'- TCTCAGACAAGTTTGGGGC -3'
(R):5'- CCTTGCGGGGTCTTTGGAG -3'
Posted On2015-09-25