Incidental Mutation 'R4601:Celf2'
ID345596
Institutional Source Beutler Lab
Gene Symbol Celf2
Ensembl Gene ENSMUSG00000002107
Gene NameCUGBP, Elav-like family member 2
SynonymsNapor-2, ETR-3, B230345P09Rik, Cugbp2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.595) question?
Stock #R4601 (G1)
Quality Score195
Status Not validated
Chromosome2
Chromosomal Location6539694-7509563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 6586020 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 279 (N279K)
Ref Sequence ENSEMBL: ENSMUSP00000138297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002176] [ENSMUST00000100429] [ENSMUST00000114924] [ENSMUST00000114927] [ENSMUST00000114934] [ENSMUST00000142941] [ENSMUST00000150624] [ENSMUST00000170438] [ENSMUST00000182404] [ENSMUST00000182706] [ENSMUST00000182851] [ENSMUST00000182879] [ENSMUST00000183091] [ENSMUST00000183209] [ENSMUST00000183984]
Predicted Effect probably benign
Transcript: ENSMUST00000002176
AA Change: N279K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000002176
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 326 355 N/A INTRINSIC
low complexity region 379 392 N/A INTRINSIC
RRM 400 473 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100429
AA Change: N279K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097996
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114924
AA Change: N321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110574
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114927
AA Change: N279K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110577
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114934
AA Change: N321K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110584
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
low complexity region 368 397 N/A INTRINSIC
low complexity region 421 434 N/A INTRINSIC
RRM 442 515 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142941
AA Change: N279K

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120459
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 385 398 N/A INTRINSIC
RRM 406 479 3.2e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150624
AA Change: N279K

PolyPhen 2 Score 0.869 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138297
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
low complexity region 341 359 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
RRM 404 477 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170438
AA Change: N321K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000130829
Gene: ENSMUSG00000002107
AA Change: N321K

DomainStartEndE-ValueType
RRM 59 137 1.29e-17 SMART
RRM 151 226 4.22e-22 SMART
low complexity region 236 265 N/A INTRINSIC
low complexity region 294 321 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
RRM 384 467 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182355
Predicted Effect probably benign
Transcript: ENSMUST00000182404
AA Change: N192K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138769
Gene: ENSMUSG00000002107
AA Change: N192K

DomainStartEndE-ValueType
RRM 22 97 4.22e-22 SMART
low complexity region 107 136 N/A INTRINSIC
low complexity region 165 192 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 254 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182706
AA Change: N315K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000138764
Gene: ENSMUSG00000002107
AA Change: N315K

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
low complexity region 362 391 N/A INTRINSIC
low complexity region 415 428 N/A INTRINSIC
RRM 436 509 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182851
AA Change: N303K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000138363
Gene: ENSMUSG00000002107
AA Change: N303K

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
low complexity region 350 379 N/A INTRINSIC
low complexity region 403 416 N/A INTRINSIC
RRM 424 497 3.2e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182879
AA Change: N279K

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138359
Gene: ENSMUSG00000002107
AA Change: N279K

DomainStartEndE-ValueType
RRM 17 95 1.29e-17 SMART
RRM 109 184 4.22e-22 SMART
low complexity region 194 223 N/A INTRINSIC
low complexity region 252 279 N/A INTRINSIC
low complexity region 281 293 N/A INTRINSIC
RRM 346 429 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183091
AA Change: N303K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138795
Gene: ENSMUSG00000002107
AA Change: N303K

DomainStartEndE-ValueType
RRM 41 119 1.29e-17 SMART
RRM 133 208 4.22e-22 SMART
low complexity region 218 247 N/A INTRINSIC
low complexity region 276 303 N/A INTRINSIC
low complexity region 305 317 N/A INTRINSIC
RRM 366 449 4.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183209
AA Change: N315K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138355
Gene: ENSMUSG00000002107
AA Change: N315K

DomainStartEndE-ValueType
RRM 53 131 1.29e-17 SMART
RRM 145 220 4.22e-22 SMART
low complexity region 230 259 N/A INTRINSIC
low complexity region 288 315 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
RRM 378 461 4.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183269
Predicted Effect probably benign
Transcript: ENSMUST00000183984
AA Change: N366K

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000138974
Gene: ENSMUSG00000002107
AA Change: N366K

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
RRM 104 182 1.29e-17 SMART
RRM 196 271 4.22e-22 SMART
low complexity region 281 310 N/A INTRINSIC
low complexity region 339 366 N/A INTRINSIC
low complexity region 368 380 N/A INTRINSIC
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Cfap126 G T 1: 171,114,058 G41C possibly damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dgkb T C 12: 38,602,820 S735P probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam160a1 T C 3: 85,741,180 M26V probably damaging Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gif A C 19: 11,752,190 D171A probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Celf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Celf2 APN 2 6721577 missense probably benign 0.00
IGL01974:Celf2 APN 2 6604031 missense probably damaging 1.00
IGL02159:Celf2 APN 2 6604177 nonsense probably null
LCD18:Celf2 UTSW 2 6779076 intron probably benign
R0113:Celf2 UTSW 2 6624714 missense probably damaging 1.00
R0511:Celf2 UTSW 2 6604176 missense probably damaging 1.00
R0711:Celf2 UTSW 2 6721415 critical splice donor site probably null
R1755:Celf2 UTSW 2 6884958 start codon destroyed probably benign 0.01
R1802:Celf2 UTSW 2 6549933 missense probably damaging 1.00
R1898:Celf2 UTSW 2 6604164 missense probably damaging 1.00
R1912:Celf2 UTSW 2 6615753 missense probably damaging 1.00
R2422:Celf2 UTSW 2 6553889 missense probably damaging 1.00
R2848:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R2849:Celf2 UTSW 2 6604125 missense probably damaging 0.96
R3708:Celf2 UTSW 2 6624678 missense probably damaging 1.00
R4295:Celf2 UTSW 2 6604064 missense probably benign 0.10
R4602:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4610:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4611:Celf2 UTSW 2 6586020 missense possibly damaging 0.87
R4667:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4668:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4669:Celf2 UTSW 2 6721528 missense probably benign 0.44
R4790:Celf2 UTSW 2 6549903 missense probably damaging 1.00
R5022:Celf2 UTSW 2 6607847 intron probably benign
R5369:Celf2 UTSW 2 7081081 intron probably benign
R5540:Celf2 UTSW 2 6553932 missense probably benign 0.43
R5805:Celf2 UTSW 2 6553787 missense probably damaging 1.00
R5913:Celf2 UTSW 2 7081158 start codon destroyed probably null 0.02
R6330:Celf2 UTSW 2 6884955 missense probably benign 0.05
X0018:Celf2 UTSW 2 6553913 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAAGCCAGAGACCCTGTGC -3'
(R):5'- TCACAGGATCAAGTGCAAGG -3'

Sequencing Primer
(F):5'- TGTGCAGGCTTCCCGACAC -3'
(R):5'- TCAAGTGCAAGGGTTTAGATGG -3'
Posted On2015-09-25