Incidental Mutation 'R0254:Klk13'
ID34560
Institutional Source Beutler Lab
Gene Symbol Klk13
Ensembl Gene ENSMUSG00000054046
Gene Namekallikrein related-peptidase 13
SynonymsmGk-13
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R0254 (G1)
Quality Score176
Status Validated
Chromosome7
Chromosomal Location43712567-43727534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43723821 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 193 (V193A)
Ref Sequence ENSEMBL: ENSMUSP00000065308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066834] [ENSMUST00000205457] [ENSMUST00000206554]
Predicted Effect probably benign
Transcript: ENSMUST00000066834
AA Change: V193A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065308
Gene: ENSMUSG00000054046
AA Change: V193A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Tryp_SPc 36 259 4.47e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect probably benign
Transcript: ENSMUST00000205457
AA Change: V92A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206554
Meta Mutation Damage Score 0.07 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: Kallikreins are serine proteases encoded by a cluster of highly related genes on chromosome 7. When genomic sequence became available, it was possible to clarify the gene-to-sequence relationship for this family. Until January, 2006, NM_010115 was called kallikrein 13. After that time, NM_001039042 was called Klk13 and NM_010115 was called Klk1b26. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M578K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 G1522V probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S23P probably damaging Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L4977P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N209K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 S74P probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Klk13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Klk13 APN 7 43726636 missense possibly damaging 0.88
IGL02365:Klk13 APN 7 43723866 unclassified possibly damaging 0.62
IGL02792:Klk13 APN 7 43721414 missense possibly damaging 0.67
IGL03105:Klk13 APN 7 43721480 missense probably benign 0.01
IGL03246:Klk13 APN 7 43720998 missense probably damaging 0.98
R0973:Klk13 UTSW 7 43721158 critical splice donor site probably null
R0973:Klk13 UTSW 7 43721158 critical splice donor site probably null
R0974:Klk13 UTSW 7 43721158 critical splice donor site probably null
R1960:Klk13 UTSW 7 43721007 missense possibly damaging 0.74
R4607:Klk13 UTSW 7 43713860 nonsense probably null
R4608:Klk13 UTSW 7 43713860 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCTGAGACTCGTCCCACC -3'
(R):5'- TCAGGGAGATGGAGAGTCACACAC -3'

Sequencing Primer
(F):5'- agccacctccccagtcc -3'
(R):5'- cacacacacacacacacac -3'
Posted OnMay 09, 2013