Incidental Mutation 'R4601:Dgkb'
ID345651
Institutional Source Beutler Lab
Gene Symbol Dgkb
Ensembl Gene ENSMUSG00000036095
Gene Namediacylglycerol kinase, beta
SynonymsC630029D13Rik, DGK-beta
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R4601 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location37817726-38634239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38602820 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 735 (S735P)
Ref Sequence ENSEMBL: ENSMUSP00000152378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040500] [ENSMUST00000220990]
Predicted Effect probably damaging
Transcript: ENSMUST00000040500
AA Change: S735P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037900
Gene: ENSMUSG00000036095
AA Change: S735P

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 6 141 1.4e-49 PFAM
EFh 145 173 1.82e-4 SMART
EFh 190 218 1.18e-3 SMART
C1 235 286 7.11e-16 SMART
C1 302 350 9.25e-6 SMART
DAGKc 429 553 2.58e-68 SMART
DAGKa 573 753 8.02e-106 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220990
AA Change: S735P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222922
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Diacylglycerol kinases (DGKs) are regulators of the intracellular concentration of the second messenger diacylglycerol (DAG) and thus play a key role in cellular processes. Nine mammalian isotypes have been identified, which are encoded by separate genes. Mammalian DGK isozymes contain a conserved catalytic (kinase) domain and a cysteine-rich domain (CRD). The protein encoded by this gene is a diacylglycerol kinase, beta isotype. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transposon distruption have defects in long term potentiation, synapase morphology, and in spatial reference and working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
4930435E12Rik A G 16: 38,828,018 V243A probably benign Het
Aars2 T A 17: 45,516,921 D555E probably damaging Het
Abca16 T G 7: 120,436,697 F334L probably damaging Het
Abcc4 T A 14: 118,632,163 M186L probably benign Het
Agap3 T C 5: 24,476,408 L120P probably damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Aldh1a7 A T 19: 20,715,979 V192D probably damaging Het
Ankrd36 A G 11: 5,570,102 D59G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Cacna1e A G 1: 154,471,613 V936A probably benign Het
Camkv T C 9: 107,946,096 V107A probably damaging Het
Camp T C 9: 109,848,662 E80G probably damaging Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd101 G A 3: 100,993,888 T960M possibly damaging Het
Cdk18 A G 1: 132,116,919 V323A possibly damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Cemip T C 7: 83,951,618 I932V probably damaging Het
Cep250 C A 2: 155,962,053 Q28K probably benign Het
Ces2f T C 8: 104,949,964 C97R probably damaging Het
Cfap126 G T 1: 171,114,058 G41C possibly damaging Het
Chat T C 14: 32,424,155 M354V probably benign Het
Clca4b A T 3: 144,927,184 D168E possibly damaging Het
Cpxm1 T A 2: 130,393,576 M499L possibly damaging Het
Dennd3 T A 15: 73,567,160 W1126R probably damaging Het
Dlec1 T C 9: 119,147,134 probably null Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Dph5 A G 3: 115,899,777 N115D possibly damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erich3 A T 3: 154,764,738 D136V unknown Het
Exoc2 T C 13: 30,882,268 N475S probably benign Het
Fam160a1 T C 3: 85,741,180 M26V probably damaging Het
Fam217a T C 13: 34,911,302 D310G probably damaging Het
Fam53a C T 5: 33,600,663 S372N probably benign Het
Fbn2 C G 18: 58,053,733 G1699R probably damaging Het
Fbxo46 T C 7: 19,135,564 V36A probably benign Het
G6pc A G 11: 101,372,741 Y127C probably damaging Het
Gba2 A G 4: 43,573,810 F161L probably damaging Het
Gif A C 19: 11,752,190 D171A probably damaging Het
Gja1 T C 10: 56,388,229 L228P probably damaging Het
Gm20834 A G Y: 10,323,178 V86A probably benign Het
Hmcn1 A T 1: 150,738,645 C1337S probably damaging Het
Il1rl1 T A 1: 40,441,300 S30T possibly damaging Het
Itgb4 A G 11: 116,005,722 T1436A probably damaging Het
Itk T A 11: 46,336,515 Q427L probably benign Het
Klhdc4 T C 8: 121,799,527 E291G probably damaging Het
Map4 T A 9: 110,052,819 S250R possibly damaging Het
Mnt T A 11: 74,836,459 V57E possibly damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Musk A T 4: 58,301,625 I128F probably damaging Het
Myh4 G A 11: 67,250,310 A733T possibly damaging Het
Myo5a T A 9: 75,136,388 F220I probably damaging Het
Npas3 A G 12: 54,044,578 H305R probably damaging Het
Nrcam A T 12: 44,591,056 Y1132F probably damaging Het
Nt5c3b A C 11: 100,432,918 D189E probably benign Het
Nuf2 A G 1: 169,506,114 L331P probably damaging Het
Nup214 C T 2: 31,997,965 T646I probably benign Het
Olfr112 T C 17: 37,564,185 N42S probably damaging Het
Pcdh18 T C 3: 49,744,725 E1096G probably damaging Het
Pgm1 T A 5: 64,107,727 F364I probably benign Het
Pikfyve A G 1: 65,234,262 N612S probably damaging Het
Pla2g4e T G 2: 120,186,382 H226P possibly damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Prkd2 G T 7: 16,843,648 probably benign Het
Rnf133 T C 6: 23,649,042 E296G possibly damaging Het
Sav1 A T 12: 69,984,321 D142E probably benign Het
Scn3b C A 9: 40,288,423 P212T probably damaging Het
Sel1l A T 12: 91,833,053 probably null Het
Sept9 A G 11: 117,360,484 K543E probably damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Snrpa A G 7: 27,195,533 M1T probably null Het
Soga1 T C 2: 157,039,924 K736R probably benign Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Srpk3 A G X: 73,774,941 H79R possibly damaging Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Stradb G A 1: 58,993,572 S361N probably damaging Het
Sult3a2 T C 10: 33,782,087 K10R probably benign Het
Susd4 A G 1: 182,858,460 N192D probably damaging Het
Tcp10a T A 17: 7,325,975 D32E probably benign Het
Tdpoz4 T A 3: 93,797,032 V212D probably damaging Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Traj37 T C 14: 54,181,539 probably benign Het
Ttc7b G A 12: 100,500,117 R79C probably damaging Het
Vmn2r115 T A 17: 23,346,399 L420Q probably benign Het
Wdr24 T A 17: 25,828,207 probably null Het
Wdr81 T A 11: 75,445,658 Q516L probably damaging Het
Zfp516 A G 18: 82,956,039 T121A probably benign Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Dgkb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Dgkb APN 12 38438568 missense probably benign 0.05
IGL00768:Dgkb APN 12 38427479 missense probably benign 0.00
IGL00792:Dgkb APN 12 38214389 critical splice donor site probably null
IGL00934:Dgkb APN 12 38427456 missense probably damaging 0.98
IGL00970:Dgkb APN 12 38190083 missense probably damaging 1.00
IGL01152:Dgkb APN 12 38084234 missense probably damaging 1.00
IGL01489:Dgkb APN 12 38127385 critical splice donor site probably null
IGL01993:Dgkb APN 12 37982010 missense probably benign 0.19
IGL02212:Dgkb APN 12 38139414 missense probably damaging 1.00
IGL02687:Dgkb APN 12 38630629 missense possibly damaging 0.94
IGL02986:Dgkb APN 12 38100400 missense possibly damaging 0.88
IGL03155:Dgkb APN 12 38139459 missense probably damaging 1.00
IGL03174:Dgkb APN 12 38216054 missense possibly damaging 0.93
IGL03198:Dgkb APN 12 38136616 missense probably damaging 0.97
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0063:Dgkb UTSW 12 38604113 missense probably benign
R0078:Dgkb UTSW 12 38136541 missense probably benign 0.35
R0271:Dgkb UTSW 12 38228026 missense probably damaging 1.00
R0359:Dgkb UTSW 12 38216031 missense probably benign 0.17
R0396:Dgkb UTSW 12 38190135 critical splice donor site probably null
R0547:Dgkb UTSW 12 38604158 missense probably benign 0.39
R0554:Dgkb UTSW 12 38216031 missense probably benign 0.17
R1903:Dgkb UTSW 12 38166777 critical splice donor site probably null
R2004:Dgkb UTSW 12 38084229 missense probably damaging 1.00
R2265:Dgkb UTSW 12 38190108 missense possibly damaging 0.61
R2941:Dgkb UTSW 12 38604123 missense possibly damaging 0.96
R3177:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R3277:Dgkb UTSW 12 38084217 missense probably damaging 0.98
R4319:Dgkb UTSW 12 38438599 missense probably damaging 1.00
R4446:Dgkb UTSW 12 38184953 missense probably damaging 0.99
R4578:Dgkb UTSW 12 38427493 missense possibly damaging 0.87
R4799:Dgkb UTSW 12 38114568 missense possibly damaging 0.89
R4937:Dgkb UTSW 12 38114658 nonsense probably null
R5380:Dgkb UTSW 12 38127300 missense possibly damaging 0.89
R5485:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R5556:Dgkb UTSW 12 38127364 missense probably damaging 1.00
R6198:Dgkb UTSW 12 38173823 missense probably benign
R6467:Dgkb UTSW 12 38084224 missense possibly damaging 0.65
R6467:Dgkb UTSW 12 38604105 missense probably damaging 1.00
R6792:Dgkb UTSW 12 38100425 missense possibly damaging 0.48
R7056:Dgkb UTSW 12 38100493 missense probably benign
R7116:Dgkb UTSW 12 37981990 missense probably benign 0.00
R7251:Dgkb UTSW 12 37981986 missense possibly damaging 0.77
R7265:Dgkb UTSW 12 38184932 missense possibly damaging 0.91
R7268:Dgkb UTSW 12 38147555 nonsense probably null
X0023:Dgkb UTSW 12 38227989 missense probably benign 0.00
X0027:Dgkb UTSW 12 38228125 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACAGACACTTTGTGATATGGC -3'
(R):5'- CCTGATAGGAAGTAGCTGTTAAGAC -3'

Sequencing Primer
(F):5'- GCACTGTAATTGACCACC -3'
(R):5'- GCTGTTAAGACTGTAAAATGAACTA -3'
Posted On2015-09-25