Incidental Mutation 'R0254:Olfr643'
ID34566
Institutional Source Beutler Lab
Gene Symbol Olfr643
Ensembl Gene ENSMUSG00000109824
Gene Nameolfactory receptor 643
SynonymsMOR13-2, GA_x6K02T2PBJ9-6793628-6792684
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103998800-104137405 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104059521 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 27 (H27R)
Ref Sequence ENSEMBL: ENSMUSP00000150133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074064] [ENSMUST00000138055] [ENSMUST00000217217]
Predicted Effect probably benign
Transcript: ENSMUST00000074064
AA Change: H27R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000073707
Gene: ENSMUSG00000090219
AA Change: H27R

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2.6e-124 PFAM
Pfam:7TM_GPCR_Srsx 37 255 3.1e-7 PFAM
Pfam:7tm_1 43 294 3.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217217
AA Change: H27R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M578K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S23P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L4977P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N209K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Zfp101 A T 17: 33,380,978 H601Q possibly damaging Het
Other mutations in Olfr643
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr643 APN 7 104059416 missense probably damaging 1.00
IGL00958:Olfr643 APN 7 104059413 missense probably benign 0.14
IGL02319:Olfr643 APN 7 104058933 missense probably damaging 1.00
IGL03184:Olfr643 APN 7 104058847 missense probably damaging 0.97
R0850:Olfr643 UTSW 7 104059045 missense probably benign
R1443:Olfr643 UTSW 7 104058723 missense probably damaging 1.00
R1544:Olfr643 UTSW 7 104059224 missense probably damaging 0.99
R1669:Olfr643 UTSW 7 104059309 missense probably benign 0.32
R1990:Olfr643 UTSW 7 104059128 missense possibly damaging 0.96
R2207:Olfr643 UTSW 7 104059405 missense probably damaging 1.00
R4456:Olfr643 UTSW 7 104059300 missense possibly damaging 0.70
R4719:Olfr643 UTSW 7 104058733 missense probably damaging 1.00
R5519:Olfr643 UTSW 7 104059297 nonsense probably null
Z1088:Olfr643 UTSW 7 104059316 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACATCACACGGGCATCAGTGAG -3'
(R):5'- TTTCCAGGTAATTCCAGTGCCACAG -3'

Sequencing Primer
(F):5'- TAGCGATCAAAGCTCATGGC -3'
(R):5'- GCCACAGCTCAGACTTTTCAG -3'
Posted On2013-05-09