Incidental Mutation 'R4602:Samd9l'
ID345708
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Namesterile alpha motif domain containing 9-like
SynonymsESTM25
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4602 (G1)
Quality Score217
Status Not validated
Chromosome6
Chromosomal Location3372257-3399572 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAA to GAAA at 3373937 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
Predicted Effect probably null
Transcript: ENSMUST00000120087
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3376779 missense probably damaging 0.96
IGL00550:Samd9l APN 6 3374594 missense probably benign 0.00
IGL01100:Samd9l APN 6 3375863 missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3376259 missense probably benign 0.42
IGL01553:Samd9l APN 6 3375566 missense probably damaging 0.99
IGL01575:Samd9l APN 6 3376734 missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3375120 missense probably benign 0.02
IGL01915:Samd9l APN 6 3373864 nonsense probably null
IGL02063:Samd9l APN 6 3372992 missense probably damaging 1.00
IGL02066:Samd9l APN 6 3376575 missense probably damaging 1.00
IGL02145:Samd9l APN 6 3374105 missense probably benign 0.13
IGL02163:Samd9l APN 6 3374246 missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3376197 missense probably damaging 1.00
IGL02508:Samd9l APN 6 3374798 missense probably damaging 1.00
IGL02591:Samd9l APN 6 3375760 missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3376026 missense probably damaging 1.00
IGL03058:Samd9l APN 6 3374980 missense probably damaging 0.99
IGL03068:Samd9l APN 6 3375348 nonsense probably null
IGL03160:Samd9l APN 6 3374894 missense probably damaging 1.00
IGL03372:Samd9l APN 6 3375314 missense probably damaging 1.00
IGL03385:Samd9l APN 6 3376208 missense probably damaging 0.99
boston_lager UTSW 6 3375761 missense probably benign 0.12
ipa UTSW 6 3376347 missense probably damaging 1.00
IGL03054:Samd9l UTSW 6 3376023 missense probably damaging 1.00
R0111:Samd9l UTSW 6 3374946 missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3376031 missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3377264 start gained probably benign
R0398:Samd9l UTSW 6 3374502 missense probably damaging 1.00
R0744:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3372725 missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3377064 missense probably damaging 1.00
R1110:Samd9l UTSW 6 3374267 missense probably benign 0.44
R1155:Samd9l UTSW 6 3376939 missense probably benign 0.01
R1268:Samd9l UTSW 6 3376113 missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3373947 missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3376369 missense probably benign 0.06
R1573:Samd9l UTSW 6 3375426 missense probably damaging 0.99
R1590:Samd9l UTSW 6 3375761 missense probably benign 0.12
R1611:Samd9l UTSW 6 3373771 missense probably benign 0.00
R1754:Samd9l UTSW 6 3373126 missense probably damaging 0.96
R1759:Samd9l UTSW 6 3373401 missense probably damaging 1.00
R1795:Samd9l UTSW 6 3375264 nonsense probably null
R1829:Samd9l UTSW 6 3375107 missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3376269 missense probably benign 0.01
R2154:Samd9l UTSW 6 3372945 missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3376910 missense probably benign 0.08
R3622:Samd9l UTSW 6 3374032 nonsense probably null
R3903:Samd9l UTSW 6 3376830 nonsense probably null
R3904:Samd9l UTSW 6 3376830 nonsense probably null
R3945:Samd9l UTSW 6 3377029 missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3376887 missense probably benign 0.22
R4602:Samd9l UTSW 6 3373935 missense probably damaging 1.00
R4618:Samd9l UTSW 6 3376347 missense probably damaging 1.00
R4747:Samd9l UTSW 6 3375504 nonsense probably null
R4762:Samd9l UTSW 6 3375623 missense probably benign 0.01
R4814:Samd9l UTSW 6 3372863 missense probably damaging 0.98
R4934:Samd9l UTSW 6 3375621 nonsense probably null
R5026:Samd9l UTSW 6 3375284 missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3374157 missense probably benign 0.35
R5130:Samd9l UTSW 6 3374548 missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3376156 missense probably benign 0.02
R5328:Samd9l UTSW 6 3376739 missense probably damaging 0.99
R5507:Samd9l UTSW 6 3373898 missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3373291 missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3376754 missense probably benign
R5881:Samd9l UTSW 6 3372716 missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3376460 missense probably damaging 1.00
R6131:Samd9l UTSW 6 3377252 missense probably benign 0.00
R6199:Samd9l UTSW 6 3376686 missense probably benign 0.13
R6298:Samd9l UTSW 6 3375383 missense probably damaging 1.00
R6331:Samd9l UTSW 6 3376361 missense probably damaging 1.00
R6489:Samd9l UTSW 6 3376896 missense probably benign
R6601:Samd9l UTSW 6 3377229 missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3377247 missense probably benign 0.22
R6803:Samd9l UTSW 6 3375446 missense probably damaging 0.97
R6864:Samd9l UTSW 6 3374750 missense probably benign 0.14
R6905:Samd9l UTSW 6 3375387 missense probably damaging 0.99
R6919:Samd9l UTSW 6 3376313 missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3372716 missense probably damaging 0.99
R7073:Samd9l UTSW 6 3375856 nonsense probably null
R7250:Samd9l UTSW 6 3374201 missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3372600 nonsense probably null
R7351:Samd9l UTSW 6 3374157 missense probably benign 0.35
R7423:Samd9l UTSW 6 3374408 missense probably damaging 1.00
X0026:Samd9l UTSW 6 3375560 missense probably damaging 1.00
X0066:Samd9l UTSW 6 3374477 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGACCATGCCTCAGTTC -3'
(R):5'- GCTGAAACAGACACTCTCTTTTCC -3'

Sequencing Primer
(F):5'- GTGACCATGCCTCAGTTCCATAG -3'
(R):5'- CCCCATTGATTGAAGAATTGCAG -3'
Posted On2015-09-25