Incidental Mutation 'R4602:1700029J07Rik'
ID345717
Institutional Source Beutler Lab
Gene Symbol 1700029J07Rik
Ensembl Gene ENSMUSG00000071103
Gene NameRIKEN cDNA 1700029J07 gene
Synonyms
Accession Numbers

Genbank: NM_001033148; MGI: 1916729

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4602 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45953606-45975252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45970468 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 69 (I69N)
Ref Sequence ENSEMBL: ENSMUSP00000096383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095323] [ENSMUST00000098786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095323
AA Change: I69N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092961
Gene: ENSMUSG00000071103
AA Change: I69N

DomainStartEndE-ValueType
Pfam:DUF4586 7 297 1.2e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098786
AA Change: I69N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000096383
Gene: ENSMUSG00000071103
AA Change: I69N

DomainStartEndE-ValueType
Pfam:DUF4586 8 294 6.8e-114 PFAM
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,010,825 K3158E possibly damaging Het
Ak7 G A 12: 105,713,575 V123M probably benign Het
Ankmy1 A T 1: 92,888,650 N247K probably benign Het
Atp1a1 A G 3: 101,586,943 V447A probably benign Het
Atp1a4 A C 1: 172,239,765 M600R probably damaging Het
Baat A G 4: 49,502,727 Y132H probably damaging Het
Ceacam15 A G 7: 16,671,981 V215A probably damaging Het
Celf2 G T 2: 6,586,020 N279K possibly damaging Het
Clec14a C T 12: 58,267,981 R285H probably benign Het
Ctnna1 T G 18: 35,179,827 I244R possibly damaging Het
D230025D16Rik C A 8: 105,246,888 N282K possibly damaging Het
Dcxr T A 11: 120,726,304 N105Y possibly damaging Het
Dnajc6 T C 4: 101,611,264 F166L probably damaging Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Faf1 A G 4: 109,727,428 D67G probably benign Het
Fancm G A 12: 65,124,944 R1786H probably benign Het
Fnbp1 A G 2: 31,036,540 probably null Het
Frem2 A G 3: 53,547,807 L2116S possibly damaging Het
Gbp5 A G 3: 142,503,785 E164G probably benign Het
Gm4922 A T 10: 18,784,259 Y238* probably null Het
Gm8257 A G 14: 44,656,317 Y62H probably damaging Het
Grin2b A G 6: 135,778,741 F525S probably damaging Het
Hfe2 T G 3: 96,527,553 S203A probably benign Het
Hsd17b3 C A 13: 64,063,170 probably null Het
Ighv1-23 T A 12: 114,764,559 Q81L probably benign Het
Inpp4b T C 8: 81,969,535 V366A probably damaging Het
Jak1 G T 4: 101,179,594 A283D possibly damaging Het
Kmt2d G T 15: 98,850,259 probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mettl17 T C 14: 51,888,789 V218A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Nfat5 C T 8: 107,367,223 Q699* probably null Het
Olfr1193 G A 2: 88,677,896 V14I probably benign Het
Olfr1193 T G 2: 88,678,179 V101G probably benign Het
Olfr868 C A 9: 20,101,244 H162N probably benign Het
Osbpl7 C A 11: 97,056,269 S265R possibly damaging Het
Pcdh15 A G 10: 74,594,214 T1258A probably damaging Het
Pcdh20 A T 14: 88,468,430 L478Q probably damaging Het
Pde11a A G 2: 76,158,333 V488A probably benign Het
Phactr1 A T 13: 43,094,965 E463D probably benign Het
Samd9l A T 6: 3,373,935 Y1109N probably damaging Het
Samd9l GAA GAAA 6: 3,373,937 probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Serpinb12 T A 1: 106,949,153 D66E probably benign Het
Sgk2 G A 2: 162,994,754 probably null Het
Slco1a6 C A 6: 142,101,652 C404F probably benign Het
Spaca6 C T 17: 17,831,125 A21V probably damaging Het
Sphkap G T 1: 83,279,061 Y322* probably null Het
Sptlc3 G A 2: 139,636,680 V520I probably benign Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Syt9 A T 7: 107,436,387 K204* probably null Het
Taf3 A G 2: 9,952,657 V233A probably damaging Het
Tbccd1 T C 16: 22,818,535 probably null Het
Tdrd5 T A 1: 156,284,374 T479S probably benign Het
Tex10 T C 4: 48,452,946 D671G probably benign Het
Tgtp2 T C 11: 49,058,984 T254A probably damaging Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubac1 A T 2: 25,998,977 I402N probably damaging Het
Zmat1 A T X: 134,972,945 S566T probably damaging Homo
Other mutations in 1700029J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:1700029J07Rik APN 8 45973605 unclassified probably benign
D4043:1700029J07Rik UTSW 8 45956403 missense probably damaging 1.00
R0055:1700029J07Rik UTSW 8 45968161 missense probably damaging 0.99
R0055:1700029J07Rik UTSW 8 45968161 missense probably damaging 0.99
R0894:1700029J07Rik UTSW 8 45956460 missense probably damaging 1.00
R1585:1700029J07Rik UTSW 8 45956478 missense probably benign 0.19
R4513:1700029J07Rik UTSW 8 45968138 missense probably damaging 1.00
R4600:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4601:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4603:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4610:1700029J07Rik UTSW 8 45970468 missense probably damaging 0.99
R4734:1700029J07Rik UTSW 8 45970417 missense possibly damaging 0.58
R4829:1700029J07Rik UTSW 8 45967915 missense probably damaging 1.00
R5259:1700029J07Rik UTSW 8 45962336 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTCTCCACACAAGCCATTC -3'
(R):5'- GCAAACGTTTAATTGGCTCATC -3'

Sequencing Primer
(F):5'- GCCATTCATAGTTAAAAATTGGATCC -3'
(R):5'- AGGACCCTTTAATGAGGC -3'
Posted On2015-09-25