Mutagenetix > Incidental Mutation

Incidental Mutation 'R4602:Dcxr'

345733

Institutional Source

Beutler Lab

Gene Symbol

Dcxr

Ensembl Gene

ENSMUSG00000039450

Gene Name

dicarbonyl L-xylulose reductase

Synonyms

1810027P18Rik, 0610038K04Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4602 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120616225-120618107 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 120617130 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 105 (N105Y)

Ref Sequence

ENSEMBL: ENSMUSP00000101754 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018156] [ENSMUST00000026144] [ENSMUST00000026148] [ENSMUST00000106148] [ENSMUST00000142229]

AlphaFold

Q91X52

Predicted Effect

probably benign
Transcript: ENSMUST00000018156

SMART Domains

Protein: ENSMUSP00000018156
Gene: ENSMUSG00000018012

Domain	Start	End	E-Value	Type
RHO	6	179	8.8e-139	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000026144
AA Change: N105Y

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000026144
Gene: ENSMUSG00000039450
AA Change: N105Y

Domain	Start	End	E-Value	Type
Pfam:adh_short	8	195	8.9e-51	PFAM
Pfam:KR	9	175	7.1e-9	PFAM
Pfam:Epimerase	10	227	2.3e-7	PFAM
Pfam:adh_short_C2	14	242	6.3e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000026148

SMART Domains

Protein: ENSMUSP00000026148
Gene: ENSMUSG00000025150

Domain	Start	End	E-Value	Type
Pfam:KR	9	178	8.5e-8	PFAM
Pfam:adh_short	9	195	4.6e-55	PFAM
Pfam:adh_short_C2	14	242	9.4e-31	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106148
AA Change: N105Y

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000101754
Gene: ENSMUSG00000039450
AA Change: N105Y

Domain	Start	End	E-Value	Type
Pfam:adh_short	8	151	2.1e-22	PFAM
Pfam:KR	9	151	4.7e-7	PFAM
Pfam:NAD_binding_10	11	182	3.9e-9	PFAM
Pfam:adh_short_C2	14	150	2.2e-8	PFAM
Pfam:adh_short_C2	157	234	4e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125242

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134322

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149450

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154479

Predicted Effect

probably benign
Transcript: ENSMUST00000154565

SMART Domains

Protein: ENSMUSP00000117739
Gene: ENSMUSG00000025150

Domain	Start	End	E-Value	Type
Pfam:adh_short	1	45	6.2e-10	PFAM
Pfam:adh_short_C2	33	154	9.7e-18	PFAM
Pfam:adh_short	41	123	2.2e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000142229

SMART Domains

Protein: ENSMUSP00000119523
Gene: ENSMUSG00000018012

Domain	Start	End	E-Value	Type
RHO	6	172	3.19e-127	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homotetramer to catalyze diacetyl reductase and L-xylulose reductase reactions. The encoded protein may play a role in the uronate cycle of glucose metabolism and in the cellular osmoregulation in the proximal renal tubules. Defects in this gene are a cause of pentosuria. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ahnak	A	G	19: 8,988,189 (GRCm39)	K3158E	possibly damaging	Het
Ak7	G	A	12: 105,679,834 (GRCm39)	V123M	probably benign	Het
Ankmy1	A	T	1: 92,816,372 (GRCm39)	N247K	probably benign	Het
Atp1a1	A	G	3: 101,494,259 (GRCm39)	V447A	probably benign	Het
Atp1a4	A	C	1: 172,067,332 (GRCm39)	M600R	probably damaging	Het
Baat	A	G	4: 49,502,727 (GRCm39)	Y132H	probably damaging	Het
Ceacam15	A	G	7: 16,405,906 (GRCm39)	V215A	probably damaging	Het
Celf2	G	T	2: 6,590,831 (GRCm39)	N279K	possibly damaging	Het
Cfap96	A	T	8: 46,423,505 (GRCm39)	I69N	probably damaging	Het
Clec14a	C	T	12: 58,314,767 (GRCm39)	R285H	probably benign	Het
Ctnna1	T	G	18: 35,312,880 (GRCm39)	I244R	possibly damaging	Het
Dnajc6	T	C	4: 101,468,461 (GRCm39)	F166L	probably damaging	Het
Ercc3	G	A	18: 32,378,624 (GRCm39)	A202T	probably benign	Het
Faf1	A	G	4: 109,584,625 (GRCm39)	D67G	probably benign	Het
Fancm	G	A	12: 65,171,718 (GRCm39)	R1786H	probably benign	Het
Fnbp1	A	G	2: 30,926,552 (GRCm39)		probably null	Het
Frem2	A	G	3: 53,455,228 (GRCm39)	L2116S	possibly damaging	Het
Gbp5	A	G	3: 142,209,546 (GRCm39)	E164G	probably benign	Het
Gm4922	A	T	10: 18,660,007 (GRCm39)	Y238*	probably null	Het
Gm8257	A	G	14: 44,893,774 (GRCm39)	Y62H	probably damaging	Het
Grin2b	A	G	6: 135,755,739 (GRCm39)	F525S	probably damaging	Het
Hjv	T	G	3: 96,434,869 (GRCm39)	S203A	probably benign	Het
Hsd17b3	C	A	13: 64,210,984 (GRCm39)		probably null	Het
Ighv1-23	T	A	12: 114,728,179 (GRCm39)	Q81L	probably benign	Het
Inpp4b	T	C	8: 82,696,164 (GRCm39)	V366A	probably damaging	Het
Jak1	G	T	4: 101,036,791 (GRCm39)	A283D	possibly damaging	Het
Kmt2d	G	T	15: 98,748,140 (GRCm39)		probably benign	Het
Mbtps1	A	T	8: 120,262,086 (GRCm39)	D354E	probably damaging	Het
Mettl17	T	C	14: 52,126,246 (GRCm39)	V218A	probably damaging	Het
Mrc2	G	A	11: 105,239,257 (GRCm39)		probably null	Het
Nfat5	C	T	8: 108,093,855 (GRCm39)	Q699*	probably null	Het
Or4s2b	G	A	2: 88,508,240 (GRCm39)	V14I	probably benign	Het
Or4s2b	T	G	2: 88,508,523 (GRCm39)	V101G	probably benign	Het
Or7e174	C	A	9: 20,012,540 (GRCm39)	H162N	probably benign	Het
Osbpl7	C	A	11: 96,947,095 (GRCm39)	S265R	possibly damaging	Het
Pcdh15	A	G	10: 74,430,046 (GRCm39)	T1258A	probably damaging	Het
Pcdh20	A	T	14: 88,705,866 (GRCm39)	L478Q	probably damaging	Het
Pde11a	A	G	2: 75,988,677 (GRCm39)	V488A	probably benign	Het
Phactr1	A	T	13: 43,248,441 (GRCm39)	E463D	probably benign	Het
Phaf1	C	A	8: 105,973,520 (GRCm39)	N282K	possibly damaging	Het
Samd9l	A	T	6: 3,373,935 (GRCm39)	Y1109N	probably damaging	Het
Samd9l	GAA	GAAA	6: 3,373,937 (GRCm39)		probably null	Het
Secisbp2l	C	T	2: 125,582,657 (GRCm39)	G933D	possibly damaging	Het
Serpinb12	T	A	1: 106,876,883 (GRCm39)	D66E	probably benign	Het
Sgk2	G	A	2: 162,836,674 (GRCm39)		probably null	Het
Slco1a6	C	A	6: 142,047,378 (GRCm39)	C404F	probably benign	Het
Spaca6	C	T	17: 18,051,387 (GRCm39)	A21V	probably damaging	Het
Sphkap	G	T	1: 83,256,782 (GRCm39)	Y322*	probably null	Het
Sptlc3	G	A	2: 139,478,600 (GRCm39)	V520I	probably benign	Het
Stox2	A	G	8: 47,645,970 (GRCm39)	S497P	probably damaging	Het
Syt9	A	T	7: 107,035,594 (GRCm39)	K204*	probably null	Het
Taf3	A	G	2: 9,957,468 (GRCm39)	V233A	probably damaging	Het
Tbccd1	T	C	16: 22,637,285 (GRCm39)		probably null	Het
Tdrd5	T	A	1: 156,111,944 (GRCm39)	T479S	probably benign	Het
Tex10	T	C	4: 48,452,946 (GRCm39)	D671G	probably benign	Het
Tgtp2	T	C	11: 48,949,811 (GRCm39)	T254A	probably damaging	Het
Tmtc2	T	C	10: 105,249,391 (GRCm39)	Y114C	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Ubac1	A	T	2: 25,888,989 (GRCm39)	I402N	probably damaging	Het
Zmat1	A	T	X: 133,873,694 (GRCm39)	S566T	probably damaging	Homo

Other mutations in Dcxr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01088:Dcxr	APN	11	120,616,993 (GRCm39)	missense	possibly damaging	0.75
IGL01516:Dcxr	APN	11	120,616,584 (GRCm39)	splice site	probably null
IGL02151:Dcxr	APN	11	120,616,809 (GRCm39)	missense	probably benign	0.00
IGL03264:Dcxr	APN	11	120,617,298 (GRCm39)	missense	probably damaging	1.00
R0890:Dcxr	UTSW	11	120,617,297 (GRCm39)	missense	probably damaging	1.00
R1325:Dcxr	UTSW	11	120,617,381 (GRCm39)	splice site	probably null
R1808:Dcxr	UTSW	11	120,616,438 (GRCm39)	splice site	probably null
R2099:Dcxr	UTSW	11	120,616,403 (GRCm39)	missense	probably damaging	1.00
R2102:Dcxr	UTSW	11	120,617,133 (GRCm39)	missense	probably benign	0.08
R4772:Dcxr	UTSW	11	120,616,923 (GRCm39)	missense	probably benign	0.00
R5028:Dcxr	UTSW	11	120,617,273 (GRCm39)	missense	probably damaging	0.97
R5219:Dcxr	UTSW	11	120,616,314 (GRCm39)	unclassified	probably benign
R5336:Dcxr	UTSW	11	120,618,002 (GRCm39)	critical splice donor site	probably null
R5518:Dcxr	UTSW	11	120,617,025 (GRCm39)	unclassified	probably benign
R6613:Dcxr	UTSW	11	120,617,832 (GRCm39)	missense	probably benign	0.00
R6833:Dcxr	UTSW	11	120,616,917 (GRCm39)	missense	probably damaging	1.00
R7042:Dcxr	UTSW	11	120,617,841 (GRCm39)	missense	possibly damaging	0.66
R7531:Dcxr	UTSW	11	120,617,832 (GRCm39)	missense	probably benign	0.00
R7633:Dcxr	UTSW	11	120,617,279 (GRCm39)	missense	probably benign	0.00
R7710:Dcxr	UTSW	11	120,617,908 (GRCm39)	missense	probably benign	0.08
R9128:Dcxr	UTSW	11	120,617,372 (GRCm39)	missense
R9800:Dcxr	UTSW	11	120,618,084 (GRCm39)	unclassified	probably benign
Z1176:Dcxr	UTSW	11	120,618,034 (GRCm39)	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTCAGCTGGAATTACTCACAG -3'
(R):5'- AACAATGCTGCTGTGGCTC -3'

Sequencing Primer
(F):5'- ACTCACAGTAGACAGTATGGTTGGTC -3'
(R):5'- CTGTGGCTCTGTTGCAGCC -3'

Posted On

2015-09-25