Incidental Mutation 'R4603:Kmo'
ID345757
Institutional Source Beutler Lab
Gene Symbol Kmo
Ensembl Gene ENSMUSG00000039783
Gene Namekynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location175620381-175662116 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 175651642 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 248 (P248Q)
Ref Sequence ENSEMBL: ENSMUSP00000095067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040250] [ENSMUST00000097458] [ENSMUST00000140474]
Predicted Effect probably benign
Transcript: ENSMUST00000040250
AA Change: P248Q

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038914
Gene: ENSMUSG00000039783
AA Change: P248Q

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.6e-22 PFAM
Pfam:NAD_binding_8 13 63 2.2e-7 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097458
AA Change: P248Q

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000095067
Gene: ENSMUSG00000039783
AA Change: P248Q

DomainStartEndE-ValueType
Pfam:FAD_binding_3 9 328 5.8e-22 PFAM
Pfam:NAD_binding_8 13 63 2.1e-7 PFAM
transmembrane domain 391 413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137174
Predicted Effect probably benign
Transcript: ENSMUST00000140474
SMART Domains Protein: ENSMUSP00000122943
Gene: ENSMUSG00000039783

DomainStartEndE-ValueType
Pfam:FAD_binding_3 44 240 2.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142223
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrion outer membrane protein that catalyzes the hydroxylation of L-tryptophan metabolite, L-kynurenine, to form L-3-hydroxykynurenine. Studies in yeast identified this gene as a therapeutic target for Huntington disease. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack kynurenine 3-monooxygenase activity and altered levels of several tryptophan metabolites. Mice homozygous for another null allele exhibit increased LPS-induced depressive behaviors and altered kynurenine metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Kmo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Kmo APN 1 175655095 missense possibly damaging 0.54
IGL01734:Kmo APN 1 175655102 missense probably benign 0.00
IGL02415:Kmo APN 1 175649323 splice site probably benign
IGL02551:Kmo APN 1 175637919 missense probably damaging 1.00
IGL02866:Kmo APN 1 175653588 missense probably damaging 1.00
IGL03140:Kmo APN 1 175649220 missense probably damaging 1.00
R0613:Kmo UTSW 1 175637892 missense probably damaging 1.00
R0617:Kmo UTSW 1 175647190 missense possibly damaging 0.85
R0883:Kmo UTSW 1 175647140 missense possibly damaging 0.70
R1034:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1037:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1164:Kmo UTSW 1 175658559 missense probably benign 0.00
R1519:Kmo UTSW 1 175651618 missense possibly damaging 0.95
R1519:Kmo UTSW 1 175656802 missense probably damaging 1.00
R1712:Kmo UTSW 1 175656723 missense probably benign
R1796:Kmo UTSW 1 175637895 missense probably benign 0.00
R1938:Kmo UTSW 1 175651588 missense possibly damaging 0.88
R4531:Kmo UTSW 1 175659707 unclassified probably null
R4586:Kmo UTSW 1 175650572 missense probably damaging 1.00
R4586:Kmo UTSW 1 175650573 missense possibly damaging 0.90
R4647:Kmo UTSW 1 175659774 nonsense probably null
R4728:Kmo UTSW 1 175656763 missense possibly damaging 0.51
R5569:Kmo UTSW 1 175655122 missense probably benign 0.04
R5571:Kmo UTSW 1 175647194 missense possibly damaging 0.46
R6109:Kmo UTSW 1 175637908 missense possibly damaging 0.67
R6244:Kmo UTSW 1 175659695 missense possibly damaging 0.91
R6943:Kmo UTSW 1 175658375 missense probably benign 0.00
R7148:Kmo UTSW 1 175651602 missense probably damaging 1.00
R7319:Kmo UTSW 1 175653655 missense probably damaging 0.97
R7450:Kmo UTSW 1 175639100 missense probably benign 0.01
X0027:Kmo UTSW 1 175647193 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGACACAGCGGCTCTTTC -3'
(R):5'- ACTTTGCTCTAACGCTGGC -3'

Sequencing Primer
(F):5'- GTGACAAAGCTGAGTTGAAAATTCCC -3'
(R):5'- TCAGAGGGATAGCATCTG -3'
Posted On2015-09-25