Incidental Mutation 'R4603:Scnn1a'
ID345780
Institutional Source Beutler Lab
Gene Symbol Scnn1a
Ensembl Gene ENSMUSG00000030340
Gene Namesodium channel, nonvoltage-gated 1 alpha
SynonymsENaC alpha, mENaC, Scnn1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125320659-125344943 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125322160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000080164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176365] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]
Predicted Effect probably damaging
Transcript: ENSMUST00000081440
AA Change: I94V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: I94V

DomainStartEndE-ValueType
low complexity region 13 18 N/A INTRINSIC
Pfam:ASC 88 600 1.1e-93 PFAM
low complexity region 647 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175966
AA Change: I68V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340
AA Change: I68V

DomainStartEndE-ValueType
Pfam:ASC 62 264 3.5e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176110
AA Change: I68V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: I68V

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176365
AA Change: I52V

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135467
Gene: ENSMUSG00000030340
AA Change: I52V

DomainStartEndE-ValueType
Pfam:ASC 46 141 1.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176442
SMART Domains Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.3e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176655
SMART Domains Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340

DomainStartEndE-ValueType
Pfam:ASC 1 494 6.4e-105 PFAM
low complexity region 540 570 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177329
AA Change: I68V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: I68V

DomainStartEndE-ValueType
Pfam:ASC 62 575 1.9e-112 PFAM
low complexity region 621 651 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Scnn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Scnn1a APN 6 125338379 missense probably benign 0.11
IGL01793:Scnn1a APN 6 125343703 missense probably benign 0.03
IGL01992:Scnn1a APN 6 125338937 critical splice donor site probably null
IGL03280:Scnn1a APN 6 125342781 splice site probably benign
R0086:Scnn1a UTSW 6 125342587 splice site probably benign
R0442:Scnn1a UTSW 6 125339137 missense probably damaging 1.00
R0454:Scnn1a UTSW 6 125322226 missense probably damaging 1.00
R0578:Scnn1a UTSW 6 125322244 missense probably damaging 0.97
R1538:Scnn1a UTSW 6 125338893 missense possibly damaging 0.48
R1579:Scnn1a UTSW 6 125322140 missense probably damaging 1.00
R1803:Scnn1a UTSW 6 125332194 missense probably damaging 0.98
R1876:Scnn1a UTSW 6 125338838 missense probably benign 0.05
R2113:Scnn1a UTSW 6 125337811 missense possibly damaging 0.60
R2178:Scnn1a UTSW 6 125331002 missense probably damaging 0.96
R2960:Scnn1a UTSW 6 125322293 missense probably damaging 1.00
R4072:Scnn1a UTSW 6 125338907 missense probably damaging 1.00
R4928:Scnn1a UTSW 6 125322173 missense probably damaging 1.00
R5436:Scnn1a UTSW 6 125343022 missense possibly damaging 0.94
R6812:Scnn1a UTSW 6 125337856 missense probably benign 0.09
R7089:Scnn1a UTSW 6 125337807 missense probably benign 0.05
X0026:Scnn1a UTSW 6 125322110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGCAAGACCTTTGTCCTC -3'
(R):5'- GACCTGTAAGGATTAAGGGTGC -3'

Sequencing Primer
(F):5'- GAGCAAGACCTTTGTCCTCCTCTG -3'
(R):5'- AGGGAAGACCAGCTTGTCC -3'
Posted On2015-09-25