Incidental Mutation 'R4603:Ptpre'
ID345784
Institutional Source Beutler Lab
Gene Symbol Ptpre
Ensembl Gene ENSMUSG00000041836
Gene Nameprotein tyrosine phosphatase, receptor type, E
SynonymsPTPe, RPTPepsilon, PTPepsilon
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.638) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location135537481-135686293 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 135667643 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 284 (Y284*)
Ref Sequence ENSEMBL: ENSMUSP00000147524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]
Predicted Effect probably null
Transcript: ENSMUST00000073961
AA Change: Y271*
SMART Domains Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: Y271*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
PTPc 133 395 4.65e-136 SMART
PTPc 424 690 7.36e-116 SMART
Predicted Effect probably null
Transcript: ENSMUST00000209256
AA Change: Y291*
Predicted Effect probably null
Transcript: ENSMUST00000209979
AA Change: Y214*
Predicted Effect probably null
Transcript: ENSMUST00000210833
AA Change: Y271*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211092
Predicted Effect probably null
Transcript: ENSMUST00000211140
AA Change: Y271*
Predicted Effect probably null
Transcript: ENSMUST00000211788
AA Change: Y284*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Ptpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Ptpre APN 7 135659053 missense probably damaging 0.98
IGL01019:Ptpre APN 7 135678325 nonsense probably null
IGL01115:Ptpre APN 7 135670764 missense probably damaging 1.00
IGL01456:Ptpre APN 7 135669802 missense probably damaging 1.00
IGL01516:Ptpre APN 7 135664999 missense probably damaging 0.97
IGL02108:Ptpre APN 7 135659102 missense possibly damaging 0.85
IGL02735:Ptpre APN 7 135667567 missense probably damaging 1.00
IGL03326:Ptpre APN 7 135672817 missense probably damaging 1.00
IGL03327:Ptpre APN 7 135672822 critical splice donor site probably null
R0183:Ptpre UTSW 7 135669845 missense probably benign 0.01
R0369:Ptpre UTSW 7 135670715 missense probably damaging 1.00
R0538:Ptpre UTSW 7 135663315 missense probably damaging 0.99
R0762:Ptpre UTSW 7 135679235 missense probably damaging 0.99
R1169:Ptpre UTSW 7 135667612 missense probably benign 0.33
R1214:Ptpre UTSW 7 135679258 missense probably damaging 1.00
R1629:Ptpre UTSW 7 135669799 missense probably damaging 1.00
R1654:Ptpre UTSW 7 135653928 missense probably benign 0.32
R1819:Ptpre UTSW 7 135668993 splice site probably benign
R1876:Ptpre UTSW 7 135678317 missense possibly damaging 0.73
R2049:Ptpre UTSW 7 135670695 splice site probably benign
R2284:Ptpre UTSW 7 135669781 missense probably benign 0.05
R2895:Ptpre UTSW 7 135643858 nonsense probably null
R4508:Ptpre UTSW 7 135669103 missense probably damaging 1.00
R4644:Ptpre UTSW 7 135651932 intron probably benign
R4863:Ptpre UTSW 7 135669132 missense probably benign 0.00
R4989:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5015:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5133:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5134:Ptpre UTSW 7 135652092 missense probably damaging 0.96
R5291:Ptpre UTSW 7 135678301 missense probably benign
R5372:Ptpre UTSW 7 135653940 missense possibly damaging 0.87
R5653:Ptpre UTSW 7 135653943 missense probably damaging 0.99
R5896:Ptpre UTSW 7 135674278 missense probably benign 0.39
R6238:Ptpre UTSW 7 135671180 missense probably damaging 1.00
R6974:Ptpre UTSW 7 135669148 missense possibly damaging 0.95
R7125:Ptpre UTSW 7 135654015 nonsense probably null
R7298:Ptpre UTSW 7 135683287 missense probably damaging 1.00
R7453:Ptpre UTSW 7 135538074 missense unknown
R7459:Ptpre UTSW 7 135667600 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTGCTGACACAGGTTATTTGAC -3'
(R):5'- TGCAGATTCGGGTCCTTGATC -3'

Sequencing Primer
(F):5'- GGTTATTTGACCTTATGCCACATC -3'
(R):5'- AGTCTGTCACAGGATCCAGC -3'
Posted On2015-09-25