Incidental Mutation 'R4603:Tmtc2'
ID345799
Institutional Source Beutler Lab
Gene Symbol Tmtc2
Ensembl Gene ENSMUSG00000036019
Gene Nametransmembrane and tetratricopeptide repeat containing 2
SynonymsD330034A10Rik, 8430438D04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location105187663-105574451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105413530 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 114 (Y114C)
Ref Sequence ENSEMBL: ENSMUSP00000061919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061506]
Predicted Effect probably benign
Transcript: ENSMUST00000061506
AA Change: Y114C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061919
Gene: ENSMUSG00000036019
AA Change: Y114C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 223 245 N/A INTRINSIC
Pfam:DUF1736 247 321 7.3e-33 PFAM
transmembrane domain 393 415 N/A INTRINSIC
transmembrane domain 425 444 N/A INTRINSIC
TPR 493 526 1.6e-3 SMART
TPR 527 560 6.84e-3 SMART
TPR 561 594 2.52e-1 SMART
TPR 606 639 3.12e-6 SMART
TPR 643 676 3.99e1 SMART
TPR 677 710 7.12e-1 SMART
low complexity region 729 739 N/A INTRINSIC
TPR 745 778 1.51e1 SMART
TPR 779 812 1.43e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143691
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane protein localized to the endoplasmic reticulum (ER). The encoded protein contains many tetratricopeptide repeats, sequences known for being involved in protein-protein interactions. This protein binds both the calcium uptake pump SERCA2B and the carbohydrate-binding chaperone calnexin, and it appears to play a role in calcium homeostasis in the ER. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Tmtc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tmtc2 APN 10 105321446 missense possibly damaging 0.82
IGL01284:Tmtc2 APN 10 105271511 missense possibly damaging 0.56
IGL01317:Tmtc2 APN 10 105413785 missense probably damaging 1.00
IGL01327:Tmtc2 APN 10 105348479 missense probably benign 0.15
IGL01637:Tmtc2 APN 10 105370085 missense probably benign 0.00
IGL02176:Tmtc2 APN 10 105348493 missense probably benign 0.00
IGL02354:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02361:Tmtc2 APN 10 105271526 missense probably benign 0.00
IGL02514:Tmtc2 APN 10 105190099 missense possibly damaging 0.94
IGL02540:Tmtc2 APN 10 105413339 missense probably benign 0.45
IGL02625:Tmtc2 APN 10 105370546 missense probably damaging 1.00
IGL02938:Tmtc2 APN 10 105413296 missense probably damaging 1.00
IGL02939:Tmtc2 APN 10 105370550 missense probably damaging 1.00
IGL03388:Tmtc2 APN 10 105321483 splice site probably benign
PIT4402001:Tmtc2 UTSW 10 105413407 missense probably damaging 1.00
PIT4449001:Tmtc2 UTSW 10 105303604 missense probably damaging 1.00
R1424:Tmtc2 UTSW 10 105413368 missense probably benign 0.00
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1462:Tmtc2 UTSW 10 105573705 nonsense probably null
R1529:Tmtc2 UTSW 10 105303658 missense probably damaging 1.00
R1903:Tmtc2 UTSW 10 105190108 missense probably benign 0.00
R2225:Tmtc2 UTSW 10 105370357 missense probably benign 0.22
R4280:Tmtc2 UTSW 10 105348433 critical splice donor site probably null
R4602:Tmtc2 UTSW 10 105413530 missense probably benign
R4624:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4625:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4628:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R4629:Tmtc2 UTSW 10 105303650 missense probably benign 0.04
R5192:Tmtc2 UTSW 10 105190177 missense probably damaging 1.00
R5769:Tmtc2 UTSW 10 105370046 missense probably benign 0.00
R5846:Tmtc2 UTSW 10 105271441 intron probably benign
R5892:Tmtc2 UTSW 10 105413505 missense probably benign 0.08
R5897:Tmtc2 UTSW 10 105413598 missense probably damaging 1.00
R6362:Tmtc2 UTSW 10 105369970 missense probably damaging 1.00
R6391:Tmtc2 UTSW 10 105573690 missense probably benign 0.06
R6640:Tmtc2 UTSW 10 105573749 start codon destroyed probably benign 0.01
R6812:Tmtc2 UTSW 10 105413269 missense probably benign 0.01
R6975:Tmtc2 UTSW 10 105323002 missense probably benign 0.01
R7042:Tmtc2 UTSW 10 105370616 missense probably damaging 1.00
R7063:Tmtc2 UTSW 10 105348525 missense probably damaging 1.00
R7211:Tmtc2 UTSW 10 105573726 missense probably benign 0.31
R7288:Tmtc2 UTSW 10 105413608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTTTCCAAAGCATGCTG -3'
(R):5'- TCTTCTAACCCACAGCGGTAG -3'

Sequencing Primer
(F):5'- TCCAGCGCACAATCCAGTC -3'
(R):5'- GGTAGCCACAAGTCCTACCG -3'
Posted On2015-09-25