Incidental Mutation 'R4603:Psme3'
ID345805
Institutional Source Beutler Lab
Gene Symbol Psme3
Ensembl Gene ENSMUSG00000078652
Gene Nameproteaseome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki)
Synonymspa28g, Ki, PA28gamma, REGgamma
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location101316213-101323537 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 101317609 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019470] [ENSMUST00000019470] [ENSMUST00000142640] [ENSMUST00000142640] [ENSMUST00000151385] [ENSMUST00000151385]
Predicted Effect probably null
Transcript: ENSMUST00000019470
SMART Domains Protein: ENSMUSP00000019470
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 9 69 2.9e-30 PFAM
Pfam:PA28_beta 108 252 3e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019470
SMART Domains Protein: ENSMUSP00000019470
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 9 69 2.9e-30 PFAM
Pfam:PA28_beta 108 252 3e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131170
Predicted Effect probably null
Transcript: ENSMUST00000142640
SMART Domains Protein: ENSMUSP00000118279
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 31 95 8.4e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142640
SMART Domains Protein: ENSMUSP00000118279
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 31 95 8.4e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151385
SMART Domains Protein: ENSMUSP00000116996
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 17 81 1.5e-32 PFAM
Pfam:PA28_beta 116 203 5.6e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151385
SMART Domains Protein: ENSMUSP00000116996
Gene: ENSMUSG00000078652

DomainStartEndE-ValueType
Pfam:PA28_alpha 17 81 1.5e-32 PFAM
Pfam:PA28_beta 116 203 5.6e-40 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the gamma subunit of the 11S regulator. Six gamma subunits combine to form a homohexameric ring. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous null mutants are smaller than normal with a defect in cell proliferation and increased susceptibility to fungal infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Psme3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02474:Psme3 APN 11 101317654 missense probably benign 0.09
IGL03380:Psme3 APN 11 101320026 critical splice donor site probably null
R0432:Psme3 UTSW 11 101320442 missense possibly damaging 0.84
R0545:Psme3 UTSW 11 101319904 splice site probably benign
R0747:Psme3 UTSW 11 101317046 missense probably benign 0.04
R3889:Psme3 UTSW 11 101319456 missense probably damaging 0.96
R4849:Psme3 UTSW 11 101317081 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGGCAGAAGACTTGGTGGC -3'
(R):5'- GGGCTAACATTGAGAGCAGC -3'

Sequencing Primer
(F):5'- AAGGTGAGAGACACTTTTGTTTC -3'
(R):5'- TTGCCAAAACTGAAACTAATGGTCC -3'
Posted On2015-09-25