Incidental Mutation 'R4603:Gp1bb'
ID345820
Institutional Source Beutler Lab
Gene Symbol Gp1bb
Ensembl Gene ENSMUSG00000050761
Gene Nameglycoprotein Ib, beta polypeptide
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4603 (G1)
Quality Score130
Status Not validated
Chromosome16
Chromosomal Location18620317-18622403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18621143 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 67 (L67Q)
Ref Sequence ENSEMBL: ENSMUSP00000126292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051160] [ENSMUST00000096987] [ENSMUST00000167388] [ENSMUST00000231244] [ENSMUST00000231335] [ENSMUST00000231622] [ENSMUST00000231956] [ENSMUST00000232653]
Predicted Effect probably damaging
Transcript: ENSMUST00000051160
AA Change: L75Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059270
Gene: ENSMUSG00000050761
AA Change: L75Q

DomainStartEndE-ValueType
low complexity region 7 32 N/A INTRINSIC
LRRNT 33 67 4.14e-11 SMART
low complexity region 75 94 N/A INTRINSIC
LRRCT 97 150 4.88e-14 SMART
transmembrane domain 159 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096987
SMART Domains Protein: ENSMUSP00000094750
Gene: ENSMUSG00000072214

DomainStartEndE-ValueType
Pfam:Septin 41 321 1.2e-127 PFAM
Pfam:MMR_HSR1 46 190 5.1e-7 PFAM
low complexity region 355 369 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167388
AA Change: L67Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126292
Gene: ENSMUSG00000050761
AA Change: L67Q

DomainStartEndE-ValueType
LRRNT 25 59 4.14e-11 SMART
low complexity region 67 86 N/A INTRINSIC
LRRCT 89 142 4.88e-14 SMART
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231246
Predicted Effect probably benign
Transcript: ENSMUST00000231335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231400
Predicted Effect probably benign
Transcript: ENSMUST00000231622
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231642
Predicted Effect probably benign
Transcript: ENSMUST00000231956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232152
Predicted Effect probably benign
Transcript: ENSMUST00000232653
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Platelet glycoprotein Ib (GPIb) is a heterodimeric transmembrane protein consisting of a disulfide-linked 140 kD alpha chain and 22 kD beta chain. It is part of the GPIb-V-IX system that constitutes the receptor for von Willebrand factor (VWF), and mediates platelet adhesion in the arterial circulation. GPIb alpha chain provides the VWF binding site, and GPIb beta contributes to surface expression of the receptor and participates in transmembrane signaling through phosphorylation of its intracellular domain. Mutations in the GPIb beta subunit have been associated with Bernard-Soulier syndrome, velocardiofacial syndrome and giant platelet disorder. The 206 amino acid precursor of GPIb beta is synthesized from a 1.0 kb mRNA expressed in plateletes and megakaryocytes. A 411 amino acid protein arising from a longer, unspliced transcript in endothelial cells has been described; however, the authenticity of this product has been questioned. Yet another less abundant GPIb beta mRNA species of 3.5 kb, expressed in nonhematopoietic tissues such as endothelium, brain and heart, was shown to result from inefficient usage of a non-consensus polyA signal in the neighboring upstream gene (SEPT5, septin 5). In the absence of polyadenylation from its own imperfect site, the SEPT5 gene produces read-through transcripts that use the consensus polyA signal of this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a significantly smaller than normal number of abnormally large platelets. They also display a severe bleeding phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgf8 T G 19: 45,738,153 I137L probably benign Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C G 16: 33,040,763 probably null Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Gp1bb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02225:Gp1bb APN 16 18620900 missense possibly damaging 0.79
IGL02956:Gp1bb APN 16 18620925 missense probably benign 0.06
R4610:Gp1bb UTSW 16 18621143 missense probably damaging 1.00
R7007:Gp1bb UTSW 16 18620939 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCTAGTAGAAGTGCCAATAGC -3'
(R):5'- AGTGCTTCTCTTTCAGGGC -3'

Sequencing Primer
(F):5'- CAATAGCAGCGCGTGTAGC -3'
(R):5'- TCTTTCAGGGCCCCGTG -3'
Posted On2015-09-25