Incidental Mutation 'R4603:Fgf8'
ID345829
Institutional Source Beutler Lab
Gene Symbol Fgf8
Ensembl Gene ENSMUSG00000025219
Gene Namefibroblast growth factor 8
SynonymsAigf, Fgf-8
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4603 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location45736798-45742915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45738153 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 137 (I137L)
Ref Sequence ENSEMBL: ENSMUSP00000026240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026240] [ENSMUST00000026241] [ENSMUST00000111924] [ENSMUST00000111925] [ENSMUST00000111927] [ENSMUST00000111928]
Predicted Effect probably benign
Transcript: ENSMUST00000026240
AA Change: I137L

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026240
Gene: ENSMUSG00000025219
AA Change: I137L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 49 58 N/A INTRINSIC
FGF 79 207 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026241
AA Change: I161L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000026241
Gene: ENSMUSG00000025219
AA Change: I161L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 103 231 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111924
AA Change: I33L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107555
Gene: ENSMUSG00000025219
AA Change: I33L

DomainStartEndE-ValueType
FGF 1 103 1.56e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111925
AA Change: I126L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107556
Gene: ENSMUSG00000025219
AA Change: I126L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 68 196 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111927
AA Change: I97L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107558
Gene: ENSMUSG00000025219
AA Change: I97L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 39 167 1.22e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111928
AA Change: I108L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107559
Gene: ENSMUSG00000025219
AA Change: I108L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FGF 50 178 1.22e-48 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is known to be a factor that supports androgen and anchorage independent growth of mammary tumor cells. Overexpression of this gene has been shown to increase tumor growth and angiogensis. The adult expression of this gene is restricted to testes and ovaries. Temporal and spatial pattern of this gene expression suggests its function as an embryonic epithelial factor. Studies of the mouse and chick homologs revealed roles in midbrain and limb development, organogenesis, embryo gastrulation and left-right axis determination. The alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit cardiovascular defects (including abnormal left-right axis determination), impaired limb, thymic, and craniofacial development, and prenatal or early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029J07Rik A T 8: 45,970,468 I69N probably damaging Het
1810024B03Rik A G 2: 127,187,099 V60A probably damaging Het
Afg3l1 A G 8: 123,501,935 T747A probably benign Het
Aldh4a1 T C 4: 139,643,429 S408P probably damaging Het
Ank2 T C 3: 127,032,016 T445A probably benign Het
Antxrl A G 14: 34,075,835 E589G possibly damaging Het
Arhgef12 C T 9: 43,010,193 G329R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
AY358078 T A 14: 51,826,075 C393S possibly damaging Het
Brca2 T A 5: 150,536,165 C302S possibly damaging Het
Ccdc169 T A 3: 55,150,805 M4K probably benign Het
Ccdc66 T C 14: 27,500,420 N122S probably damaging Het
Cd226 T C 18: 89,207,219 V80A probably damaging Het
Cdc73 T C 1: 143,677,857 probably null Het
Cse1l T C 2: 166,944,532 V604A probably benign Het
Cxcr1 G C 1: 74,192,737 T42S probably benign Het
Dhx9 TCC TC 1: 153,467,051 probably null Het
Ercc3 G A 18: 32,245,571 A202T probably benign Het
Erp27 A G 6: 136,919,949 V85A probably damaging Het
Fgfrl1 T A 5: 108,703,535 V106D probably damaging Het
Gaa T C 11: 119,278,958 W613R probably damaging Het
Gabarap A G 11: 69,994,461 N66S probably benign Het
Gm13103 T A 4: 143,852,881 H345Q probably benign Het
Gm13178 A G 4: 144,703,228 V397A probably benign Het
Gp1bb A T 16: 18,621,143 L67Q probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Gstt1 T C 10: 75,794,135 Y48C probably damaging Het
Impad1 T C 4: 4,767,878 I299M probably damaging Het
Iqcg C T 16: 33,040,764 R194K probably null Het
Iqcg C G 16: 33,040,763 probably null Het
Kcnj3 C T 2: 55,446,979 R286* probably null Het
Klhl38 T A 15: 58,323,220 I38F possibly damaging Het
Kmo C A 1: 175,651,642 P248Q probably benign Het
Mbtps1 A T 8: 119,535,347 D354E probably damaging Het
Mcpt9 C T 14: 56,028,592 V60M probably damaging Het
Mical3 C A 6: 120,934,838 E1083* probably null Het
Mprip T C 11: 59,731,573 V162A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Myocd T C 11: 65,187,745 D408G possibly damaging Het
Myt1l A G 12: 29,842,540 T59A probably benign Het
Ndufb7 A G 8: 83,566,865 E16G probably damaging Het
Ndufs7 T A 10: 80,256,667 Y203* probably null Het
Nploc4 C T 11: 120,385,787 V478I probably benign Het
Nrap A G 19: 56,335,024 probably null Het
Oit1 T A 14: 8,358,429 S57C probably damaging Het
Olfr513 A T 7: 108,755,627 Y257F probably damaging Het
Olfr777 G A 10: 129,268,405 A306V probably benign Het
Pald1 T C 10: 61,348,616 T241A probably benign Het
Pdss2 T C 10: 43,372,201 S234P probably damaging Het
Pias2 T A 18: 77,130,107 V335E probably damaging Het
Ppip5k2 C A 1: 97,755,136 K187N probably damaging Het
Ppp3cb T C 14: 20,520,646 N339S possibly damaging Het
Ppp4r1 T G 17: 65,813,464 C181G probably damaging Het
Prkdc G A 16: 15,810,824 E3478K probably damaging Het
Prpf4b T C 13: 34,888,164 probably benign Het
Psme3 T A 11: 101,317,609 probably null Het
Ptpre C A 7: 135,667,643 Y284* probably null Het
Scnn1a A G 6: 125,322,160 I94V probably damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Shc2 T C 10: 79,623,856 D418G probably benign Het
Sidt1 A T 16: 44,255,026 D661E probably damaging Het
Slc35e2 T C 4: 155,617,649 F290S probably benign Het
Sorcs1 A G 19: 50,312,964 probably null Het
Stox2 A G 8: 47,192,935 S497P probably damaging Het
Tmem270 C A 5: 134,901,628 E260* probably null Het
Tmtc2 T C 10: 105,413,530 Y114C probably benign Het
Trim46 A G 3: 89,243,651 F188S probably benign Het
Trim7 T A 11: 48,837,528 M1K probably null Het
Txnip A G 3: 96,558,288 E18G probably benign Het
Usp34 A G 11: 23,464,633 N2859D probably damaging Het
Vmn2r94 T A 17: 18,257,385 I255F probably benign Het
Xkr5 T A 8: 18,933,717 N603I possibly damaging Het
Zfp512 C T 5: 31,480,226 A497V probably benign Het
Zfp518b T C 5: 38,673,627 N345S probably damaging Het
Other mutations in Fgf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02184:Fgf8 APN 19 45737216 missense probably damaging 1.00
IGL02282:Fgf8 APN 19 45737090 missense possibly damaging 0.72
IGL03083:Fgf8 APN 19 45737228 missense probably damaging 1.00
R1499:Fgf8 UTSW 19 45742347 missense possibly damaging 0.46
R1967:Fgf8 UTSW 19 45741568 missense probably damaging 1.00
R5621:Fgf8 UTSW 19 45742382 missense probably benign 0.05
R7187:Fgf8 UTSW 19 45741667 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CATCTAATCATTGGGCAAGCC -3'
(R):5'- CTTAGGGCTATCCAACCCATCC -3'

Sequencing Primer
(F):5'- CCTGCGGTAACCAAGGTAC -3'
(R):5'- CCATCCGCAAATGAGCTGG -3'
Posted On2015-09-25