Incidental Mutation 'R4604:Hax1'
ID345850
Institutional Source Beutler Lab
Gene Symbol Hax1
Ensembl Gene ENSMUSG00000027944
Gene NameHCLS1 associated X-1
SynonymsHAX-1, Hs1bp1, HS1-associated protein X-1, Silg111, mHAX-1s
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4604 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89995446-89998780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89997460 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 142 (V142D)
Ref Sequence ENSEMBL: ENSMUSP00000142445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000079724] [ENSMUST00000196843] [ENSMUST00000197432] [ENSMUST00000197725] [ENSMUST00000197767] [ENSMUST00000197786] [ENSMUST00000198322] [ENSMUST00000198782] [ENSMUST00000199050] [ENSMUST00000199163] [ENSMUST00000199740]
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000079724
AA Change: V145D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000078661
Gene: ENSMUSG00000027944
AA Change: V145D

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 248 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197432
SMART Domains Protein: ENSMUSP00000143136
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197481
Predicted Effect probably damaging
Transcript: ENSMUST00000197725
AA Change: V16D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142741
Gene: ENSMUSG00000027944
AA Change: V16D

DomainStartEndE-ValueType
low complexity region 119 131 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000197767
AA Change: V142D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142445
Gene: ENSMUSG00000027944
AA Change: V142D

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197786
SMART Domains Protein: ENSMUSP00000142627
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 30 44 N/A INTRINSIC
low complexity region 164 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000198782
AA Change: V119D

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143155
Gene: ENSMUSG00000027944
AA Change: V119D

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199014
Predicted Effect probably benign
Transcript: ENSMUST00000199050
SMART Domains Protein: ENSMUSP00000142719
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199469
Predicted Effect probably benign
Transcript: ENSMUST00000199740
SMART Domains Protein: ENSMUSP00000143557
Gene: ENSMUSG00000027944

DomainStartEndE-ValueType
SCOP:d1qbkb_ 4 18 4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200257
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200320
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is known to associate with hematopoietic cell-specific Lyn substrate 1, a substrate of Src family tyrosine kinases. It also interacts with the product of the polycystic kidney disease 2 gene, mutations in which are associated with autosomal-dominant polycystic kidney disease, and with the F-actin-binding protein, cortactin. It was earlier thought that this gene product is mainly localized in the mitochondria, however, recent studies indicate it to be localized in the cell body. Mutations in this gene result in autosomal recessive severe congenital neutropenia, also known as Kostmann disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for deletion of this gene fail to survive beyond 14 weeks of age. Apoptosis of neurons in the striatum and cerebellum occurs as does loss of lymphocytes and neutrophiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Wrnip1 A G 13: 32,802,347 D37G probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Hax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03355:Hax1 APN 3 89997447 missense possibly damaging 0.90
R0848:Hax1 UTSW 3 89995633 missense probably damaging 1.00
R1386:Hax1 UTSW 3 89995849 missense probably damaging 1.00
R1479:Hax1 UTSW 3 89995857 missense probably damaging 1.00
R4241:Hax1 UTSW 3 89995690 missense probably damaging 0.96
R5354:Hax1 UTSW 3 89997955 missense probably damaging 0.98
R5704:Hax1 UTSW 3 89996096 missense probably damaging 1.00
R5866:Hax1 UTSW 3 89995728 unclassified probably benign
R5905:Hax1 UTSW 3 89997940 small insertion probably benign
R5913:Hax1 UTSW 3 89997940 small insertion probably benign
R5914:Hax1 UTSW 3 89997940 small insertion probably benign
R5973:Hax1 UTSW 3 89997940 small insertion probably benign
R5978:Hax1 UTSW 3 89997940 small insertion probably benign
R6026:Hax1 UTSW 3 89997940 small insertion probably benign
R6028:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6035:Hax1 UTSW 3 89997940 small insertion probably benign
R6054:Hax1 UTSW 3 89997940 small insertion probably benign
R6857:Hax1 UTSW 3 89997452 missense probably damaging 0.99
R7308:Hax1 UTSW 3 89998566 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCAGAGGCAGGCAGATATC -3'
(R):5'- TGCAGAGTAGTTGGGATAGTCTACAG -3'

Sequencing Primer
(F):5'- TCCAGAGGCAGGCAGATATCTAAATC -3'
(R):5'- GTAGTTGGGATAGTCTACAGAAATTG -3'
Posted On2015-09-25