Incidental Mutation 'R4604:Wrnip1'
ID345917
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene NameWerner helicase interacting protein 1
Synonyms4833444L21Rik, WHIP
MMRRC Submission 041816-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4604 (G1)
Quality Score123
Status Not validated
Chromosome13
Chromosomal Location32802038-32822609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32802347 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
Predicted Effect probably damaging
Transcript: ENSMUST00000021832
AA Change: D37G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: D37G

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057911
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930518I15Rik C T 2: 156,857,154 probably benign Het
Abcb6 G A 1: 75,179,877 T81I probably benign Het
Acp6 A G 3: 97,175,759 K362R probably benign Het
Adam26a A G 8: 43,570,051 M134T probably benign Het
Ankrd27 C T 7: 35,628,490 P812S probably damaging Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Atp2a1 G A 7: 126,448,623 R672C probably damaging Het
Atxn2 G T 5: 121,781,343 W371C probably damaging Het
B3gnt2 T TTCACAAA 11: 22,836,426 probably null Het
Btnl6 T A 17: 34,508,461 D365V possibly damaging Het
Ccdc80 T A 16: 45,095,565 L228Q probably damaging Het
Cdc42bpa A G 1: 180,109,194 H718R probably benign Het
Cdh18 A G 15: 23,474,368 K775E probably benign Het
Cdh23 T G 10: 60,337,666 N1679T possibly damaging Het
Cep192 T A 18: 67,815,922 D271E possibly damaging Het
Cfap70 G T 14: 20,443,661 T124K probably benign Het
Ckap5 A T 2: 91,578,131 E890D probably benign Het
Col22a1 G T 15: 71,952,339 P569T probably benign Het
Colq A T 14: 31,545,103 L150Q possibly damaging Het
Csf1 T C 3: 107,756,962 probably null Het
Csmd3 A T 15: 48,004,815 S770T possibly damaging Het
Cul9 C A 17: 46,530,146 V733L probably damaging Het
Cyp2c55 A G 19: 39,031,386 D256G possibly damaging Het
D17Wsu92e T C 17: 27,820,315 D7G probably damaging Het
Dclk3 A T 9: 111,469,185 D599V probably damaging Het
Defb26 T A 2: 152,508,184 I59F possibly damaging Het
Dnah6 A G 6: 73,129,660 V1646A possibly damaging Het
Dnm2 T C 9: 21,504,664 probably null Het
Dock6 A G 9: 21,802,540 L1867P probably damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Dync2h1 T C 9: 7,140,995 H1344R probably benign Het
Enam A C 5: 88,504,283 Q1217P possibly damaging Het
Fbf1 A T 11: 116,158,922 D91E possibly damaging Het
Fbxo7 T G 10: 86,046,802 W393G probably damaging Het
Gab2 A G 7: 97,304,213 T599A probably damaging Het
Gfy T A 7: 45,177,188 I409F possibly damaging Het
Gm19345 T A 7: 19,857,508 probably null Het
Gm4787 A G 12: 81,379,213 M57T probably benign Het
Gper1 A G 5: 139,426,725 E275G probably damaging Het
Grik4 T C 9: 42,524,586 E803G probably damaging Het
Gstm3 G A 3: 107,968,197 P39L possibly damaging Het
Hax1 A T 3: 89,997,460 V142D probably damaging Het
Hcn3 A T 3: 89,150,440 I383N probably damaging Het
Hdac10 C A 15: 89,125,397 probably null Het
Hipk3 A C 2: 104,439,329 M505R probably damaging Het
Hivep1 C T 13: 42,159,749 P1822S probably benign Het
Hsd17b13 G T 5: 103,956,258 H281N unknown Het
Irak2 T A 6: 113,672,887 I222N probably damaging Het
Kalrn G A 16: 34,513,926 L7F possibly damaging Het
Kcnma1 A G 14: 23,309,038 probably null Het
Kcnn3 G T 3: 89,520,420 probably benign Het
Lamb1 A C 12: 31,278,776 D218A probably damaging Het
Lrrtm1 A T 6: 77,244,144 N195Y probably damaging Het
Ltf A T 9: 111,022,341 N72I probably damaging Het
Mcm4 A G 16: 15,629,663 I479T probably damaging Het
Mfhas1 T C 8: 35,588,610 S80P probably benign Het
Mknk1 A G 4: 115,878,027 E364G probably damaging Het
Msh4 C T 3: 153,872,283 C458Y probably damaging Het
Mtrr A T 13: 68,564,512 probably null Het
Myo1a T C 10: 127,711,138 W356R probably damaging Het
Nbea A G 3: 55,723,648 V2186A probably benign Het
Nfe2l3 T C 6: 51,451,012 S185P probably damaging Het
Nhsl1 A C 10: 18,531,410 K1397Q probably damaging Het
Nmbr C T 10: 14,770,164 R261W probably damaging Het
Npy2r A G 3: 82,541,058 S137P probably damaging Het
Obscn C T 11: 59,080,205 G2494D probably damaging Het
Obscn T C 11: 59,122,746 K1092E probably damaging Het
Olfr1019 C T 2: 85,841,182 C203Y probably damaging Het
Oosp2 A C 19: 11,649,683 I92S probably benign Het
Pcdh9 T C 14: 93,887,180 D518G probably damaging Het
Pde11a G T 2: 76,337,793 T272K possibly damaging Het
Plekha2 T A 8: 25,059,835 Q162L probably null Het
Prkag2 T A 5: 24,878,734 I84F probably damaging Het
Prm2 G T 16: 10,791,749 probably benign Het
Prpf40a A T 2: 53,142,023 C800S probably damaging Het
Prr5l A T 2: 101,729,448 C158S probably benign Het
Prrt3 C A 6: 113,498,237 C8F possibly damaging Het
Psg25 T C 7: 18,529,803 T32A probably benign Het
Ruvbl1 T C 6: 88,485,905 V337A probably benign Het
Sall1 T A 8: 89,030,341 Q1045L probably damaging Het
Sec22c T C 9: 121,695,642 Y25C probably damaging Het
Serpina3i A T 12: 104,267,777 T335S possibly damaging Het
Setd1b TCCACCACCACCACCACCACCACCA TCCACCACCACCACCACCACCA 5: 123,152,074 probably benign Het
Slc12a8 T A 16: 33,608,159 I279N probably damaging Het
Slc15a1 G A 14: 121,489,907 T83I probably damaging Het
Slc22a3 A G 17: 12,459,771 F222S probably benign Het
Sorcs3 A T 19: 48,693,914 T463S probably benign Het
Spsb4 C A 9: 96,995,878 A131S probably benign Het
Syne2 A G 12: 75,967,710 E3225G probably damaging Het
Tchp G A 5: 114,719,573 probably null Het
Tekt4 T A 17: 25,471,775 D18E probably benign Het
Timm50 A G 7: 28,311,018 V37A probably benign Het
Tlx2 A C 6: 83,068,760 *285G probably null Het
Tmem173 T A 18: 35,738,690 I170F probably damaging Het
Tshz1 C A 18: 84,013,374 D970Y probably damaging Het
Ttn A T 2: 76,870,461 V50E probably damaging Het
Txndc17 T A 11: 72,209,448 S113T probably benign Het
Tyk2 T C 9: 21,108,009 Y1039C probably damaging Het
Ubqln3 A G 7: 104,142,491 S131P probably benign Het
Uncx A T 5: 139,544,082 H30L possibly damaging Het
Usp25 T A 16: 77,115,415 D1007E probably damaging Het
Usp47 T C 7: 112,101,831 V1083A probably damaging Het
Wdr24 T A 17: 25,828,505 H765Q probably damaging Het
Xpo6 T C 7: 126,113,752 T686A possibly damaging Het
Zfp941 G A 7: 140,812,211 R412C probably damaging Het
Znrf2 T A 6: 54,878,440 C71* probably null Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 32816329 missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32806874 missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 32822070 missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 32820297 missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32806864 missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 32821906 missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32806813 missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 32821090 missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32805379 missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32805336 critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 32820240 missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32802427 missense probably benign
R2475:Wrnip1 UTSW 13 32806958 missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32802761 missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32806883 missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 32816312 missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 32816336 missense probably damaging 1.00
R5148:Wrnip1 UTSW 13 32806856 missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32806966 missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32802756 missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32802749 missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32802633 missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 32816281 missense probably benign 0.33
R7468:Wrnip1 UTSW 13 32816377 missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 32816327 nonsense probably null
X0019:Wrnip1 UTSW 13 32806766 missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32802724 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGACTACACTTCCCGACAC -3'
(R):5'- GTGCGTCGTAGCTCTCAC -3'

Sequencing Primer
(F):5'- TTCCCGACACGACTCGC -3'
(R):5'- GTCGTAGCTCTCACGGCTC -3'
Posted On2015-09-25