Incidental Mutation 'R4606:Abcb5'
ID346036
Institutional Source Beutler Lab
Gene Symbol Abcb5
Ensembl Gene ENSMUSG00000072791
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 5
Synonyms9230106F14Rik
MMRRC Submission 041817-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R4606 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location118867824-118966421 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 118932610 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035515]
Predicted Effect probably null
Transcript: ENSMUST00000035515
SMART Domains Protein: ENSMUSP00000046177
Gene: ENSMUSG00000072791

DomainStartEndE-ValueType
Pfam:ABC_membrane 49 338 1.9e-74 PFAM
AAA 414 606 2.1e-19 SMART
Pfam:ABC_membrane 693 967 7.3e-59 PFAM
Blast:AAA 969 1040 2e-11 BLAST
AAA 1043 1231 8.26e-18 SMART
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ABCB5 belongs to the ATP-binding cassette (ABC) transporter superfamily of integral membrane proteins. These proteins participate in ATP-dependent transmembrane transport of structurally diverse molecules ranging from small ions, sugars, and peptides to more complex organic molecules (Chen et al., 2005 [PubMed 15760339]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik A T 8: 79,210,745 W178R probably benign Het
Akr1b3 C A 6: 34,306,664 probably benign Het
Arid1a A G 4: 133,687,323 F1199S unknown Het
Atp4b A G 8: 13,389,998 F116S probably damaging Het
Atp6v1b1 T C 6: 83,752,461 S127P probably damaging Het
Blk C T 14: 63,374,203 V428I probably benign Het
C87414 A T 5: 93,636,602 D137E probably damaging Het
Ccser1 T C 6: 61,311,584 S244P probably damaging Het
Ceacam1 T A 7: 25,474,526 I235F probably damaging Het
Cyp2g1 T A 7: 26,814,154 Y173N possibly damaging Het
Ddr2 T A 1: 170,001,852 I278F probably benign Het
Degs1 T C 1: 182,276,823 D299G probably damaging Het
Dip2b G A 15: 100,215,329 V1542I possibly damaging Het
Dmxl1 T A 18: 49,962,181 S2942R probably damaging Het
Dpf1 T A 7: 29,316,590 probably benign Het
Ephb6 A G 6: 41,616,574 Y518C probably benign Het
Eps15l1 A T 8: 72,373,916 F606I possibly damaging Het
Extl1 A G 4: 134,371,379 S114P probably damaging Het
Extl1 A C 4: 134,371,380 D113E probably benign Het
Fat1 T C 8: 44,950,683 V157A possibly damaging Het
Fcho1 A T 8: 71,712,480 D444E probably benign Het
Fgd3 T A 13: 49,296,560 D71V probably damaging Het
Fgd5 T A 6: 91,988,209 D316E possibly damaging Het
Gys2 A T 6: 142,454,484 F334I possibly damaging Het
Ik G T 18: 36,753,555 R360L possibly damaging Het
Kazn A C 4: 142,118,288 probably null Het
Kmt2d A T 15: 98,839,716 probably benign Het
Krr1 T C 10: 111,975,677 probably benign Het
Krt83 C T 15: 101,487,049 E389K probably benign Het
Lrrc4c T C 2: 97,630,313 V428A probably benign Het
Lvrn C A 18: 46,864,765 T260K possibly damaging Het
Mcc C T 18: 44,468,421 E614K probably damaging Het
Msrb3 A T 10: 120,849,997 V81D probably damaging Het
Muc19 C T 15: 91,934,383 noncoding transcript Het
Myadm T A 7: 3,297,400 L226* probably null Het
Myof C T 19: 37,967,099 V526M probably damaging Het
Nckap5l A G 15: 99,429,323 probably benign Het
Olfr1010 T A 2: 85,753,940 probably benign Het
Olfr1260 C A 2: 89,978,006 A76D possibly damaging Het
Olfr1270 G T 2: 90,148,816 probably benign Het
Olfr398 A G 11: 73,983,892 S239P probably damaging Het
Pars2 T C 4: 106,654,050 V307A probably benign Het
Pcdhb1 T G 18: 37,265,528 Y177* probably null Het
Pcdhb4 T A 18: 37,308,652 D338E probably damaging Het
Pik3r2 G A 8: 70,772,136 R199* probably null Het
Pla2g4f C T 2: 120,313,986 R24Q probably benign Het
Pnma2 T C 14: 66,916,232 I35T probably benign Het
Podn C A 4: 108,017,867 A568S probably benign Het
Pou3f1 A T 4: 124,658,836 E377V probably damaging Het
Ppfia1 T C 7: 144,485,192 D494G probably damaging Het
Ptpn9 A T 9: 57,022,211 T71S possibly damaging Het
Ptprz1 C T 6: 23,001,487 P1192L possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnf217 T A 10: 31,517,476 K370* probably null Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Scaper A T 9: 55,655,903 probably null Het
Sos2 T C 12: 69,614,606 probably benign Het
Sptbn5 C T 2: 120,067,446 probably null Het
Sumo1 A G 1: 59,644,509 probably benign Het
Syne2 C A 12: 75,989,253 N3771K probably damaging Het
Tbx18 T C 9: 87,730,769 I26V possibly damaging Het
Trpm3 T A 19: 22,978,624 M1140K probably benign Het
Usp29 G A 7: 6,963,357 probably null Het
Wdr7 C T 18: 63,779,945 Q946* probably null Het
Ythdf1 T C 2: 180,912,182 D46G probably damaging Het
Zfp217 T C 2: 170,119,750 N219S possibly damaging Het
Zkscan3 A G 13: 21,393,783 I256T probably benign Het
Other mutations in Abcb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcb5 APN 12 118890610 missense probably benign 0.03
IGL00092:Abcb5 APN 12 118928695 missense probably benign 0.09
IGL00503:Abcb5 APN 12 118907601 missense probably benign 0.02
IGL00776:Abcb5 APN 12 118919854 missense probably damaging 1.00
IGL01116:Abcb5 APN 12 118886176 missense probably benign
IGL01302:Abcb5 APN 12 118918200 missense probably damaging 1.00
IGL01403:Abcb5 APN 12 118872867 missense probably damaging 1.00
IGL01453:Abcb5 APN 12 118867970 missense probably damaging 1.00
IGL01541:Abcb5 APN 12 118911434 missense probably benign 0.03
IGL01784:Abcb5 APN 12 118890664 missense probably benign 0.14
IGL01967:Abcb5 APN 12 118867972 missense probably damaging 1.00
IGL01987:Abcb5 APN 12 118927358 missense probably damaging 1.00
IGL02104:Abcb5 APN 12 118940680 missense probably damaging 1.00
IGL02161:Abcb5 APN 12 118874755 missense probably benign
IGL02292:Abcb5 APN 12 118918197 missense probably damaging 1.00
IGL02381:Abcb5 APN 12 118940678 missense probably damaging 1.00
IGL02544:Abcb5 APN 12 118906268 splice site probably benign
IGL02685:Abcb5 APN 12 118905947 missense probably damaging 0.99
IGL02824:Abcb5 APN 12 118890685 missense probably benign 0.05
IGL02876:Abcb5 APN 12 118919841 missense probably damaging 1.00
IGL02929:Abcb5 APN 12 118944939 missense probably damaging 0.99
IGL03030:Abcb5 APN 12 118940369 missense possibly damaging 0.93
IGL03062:Abcb5 APN 12 118936087 missense probably benign 0.43
IGL03200:Abcb5 APN 12 118965254 splice site probably benign
IGL03407:Abcb5 APN 12 118940376 missense probably benign 0.01
F5770:Abcb5 UTSW 12 118886179 missense probably benign 0.07
R0078:Abcb5 UTSW 12 118927394 missense probably benign
R0219:Abcb5 UTSW 12 118886150 splice site probably benign
R0312:Abcb5 UTSW 12 118872837 missense probably damaging 1.00
R0347:Abcb5 UTSW 12 118965251 splice site probably benign
R0359:Abcb5 UTSW 12 118940332 missense probably damaging 1.00
R0433:Abcb5 UTSW 12 118877810 missense probably benign 0.03
R0582:Abcb5 UTSW 12 118940412 missense probably benign 0.40
R0815:Abcb5 UTSW 12 118901449 splice site probably benign
R0900:Abcb5 UTSW 12 118940624 missense probably damaging 1.00
R0942:Abcb5 UTSW 12 118906198 missense possibly damaging 0.94
R0988:Abcb5 UTSW 12 118932575 missense probably benign 0.36
R1125:Abcb5 UTSW 12 118911547 missense possibly damaging 0.87
R1437:Abcb5 UTSW 12 118874762 missense probably damaging 0.99
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1469:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R1678:Abcb5 UTSW 12 118965329 start gained probably benign
R1726:Abcb5 UTSW 12 118874801 splice site probably null
R1726:Abcb5 UTSW 12 118907532 missense possibly damaging 0.95
R1836:Abcb5 UTSW 12 118867961 missense possibly damaging 0.93
R1934:Abcb5 UTSW 12 118907500 splice site probably null
R1976:Abcb5 UTSW 12 118890682 missense probably benign
R2005:Abcb5 UTSW 12 118877827 missense probably benign 0.15
R2068:Abcb5 UTSW 12 118940568 nonsense probably null
R2181:Abcb5 UTSW 12 118867946 missense possibly damaging 0.83
R2191:Abcb5 UTSW 12 118867956 missense probably damaging 1.00
R3690:Abcb5 UTSW 12 118872933 missense probably damaging 1.00
R3746:Abcb5 UTSW 12 118874620 missense probably damaging 0.99
R3825:Abcb5 UTSW 12 118901352 splice site probably null
R3919:Abcb5 UTSW 12 118890618 missense possibly damaging 0.67
R4049:Abcb5 UTSW 12 118868669 missense probably damaging 0.99
R4409:Abcb5 UTSW 12 118872922 missense probably damaging 0.98
R4705:Abcb5 UTSW 12 118965305 missense possibly damaging 0.95
R4954:Abcb5 UTSW 12 118911434 missense probably benign 0.03
R4966:Abcb5 UTSW 12 118886891 intron probably benign
R5169:Abcb5 UTSW 12 118877817 nonsense probably null
R5327:Abcb5 UTSW 12 118911543 missense probably benign 0.01
R5333:Abcb5 UTSW 12 118867942 missense probably damaging 1.00
R5366:Abcb5 UTSW 12 118867930 missense possibly damaging 0.93
R5373:Abcb5 UTSW 12 118887177 missense probably damaging 1.00
R5399:Abcb5 UTSW 12 118911499 missense probably benign
R5416:Abcb5 UTSW 12 118907596 missense probably damaging 1.00
R5447:Abcb5 UTSW 12 118927326 missense probably damaging 1.00
R5474:Abcb5 UTSW 12 118940690 missense probably null 1.00
R5566:Abcb5 UTSW 12 118935967 missense probably damaging 0.99
R5685:Abcb5 UTSW 12 118932613 splice site probably null
R5691:Abcb5 UTSW 12 118927235 missense probably damaging 0.99
R5742:Abcb5 UTSW 12 118918257 missense probably damaging 0.96
R5852:Abcb5 UTSW 12 118927404 missense probably damaging 0.99
R5917:Abcb5 UTSW 12 118868781 nonsense probably null
R5994:Abcb5 UTSW 12 118965260 critical splice donor site probably null
R6295:Abcb5 UTSW 12 118874644 missense probably damaging 0.99
R6455:Abcb5 UTSW 12 118890549 critical splice donor site probably null
R6609:Abcb5 UTSW 12 118928762 missense probably damaging 1.00
R6753:Abcb5 UTSW 12 118944906 missense possibly damaging 0.86
R6818:Abcb5 UTSW 12 118901354 splice site probably null
R6870:Abcb5 UTSW 12 118965265 missense possibly damaging 0.87
R6944:Abcb5 UTSW 12 118911530 missense probably benign 0.06
R6957:Abcb5 UTSW 12 118907535 missense probably damaging 1.00
R6984:Abcb5 UTSW 12 118927277 missense possibly damaging 0.47
V7580:Abcb5 UTSW 12 118886179 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CCGGAGTTGAATGTTCCTATCTTTC -3'
(R):5'- TATATGCCCAGGAGAGGTATTGC -3'

Sequencing Primer
(F):5'- CAGGTTCCTTCTTAGAGTAAGGACAG -3'
(R):5'- CCCAGGAGAGGTATTGCTGGATC -3'
Posted On2015-09-25