Incidental Mutation 'R0254:Zfp101'
ID34608
Institutional Source Beutler Lab
Gene Symbol Zfp101
Ensembl Gene ENSMUSG00000055240
Gene Namezinc finger protein 101
Synonyms
MMRRC Submission 038485-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R0254 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33360507-33394641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33380978 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 601 (H601Q)
Ref Sequence ENSEMBL: ENSMUSP00000132508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167107] [ENSMUST00000174417] [ENSMUST00000174512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167107
AA Change: H601Q

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000132508
Gene: ENSMUSG00000055240
AA Change: H601Q

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
ZnF_C2H2 219 241 2.57e-3 SMART
ZnF_C2H2 247 269 6.32e-3 SMART
ZnF_C2H2 275 297 3.16e-3 SMART
ZnF_C2H2 302 322 1.65e2 SMART
ZnF_C2H2 330 352 6.75e0 SMART
ZnF_C2H2 358 380 2.75e-3 SMART
ZnF_C2H2 386 408 4.47e-3 SMART
ZnF_C2H2 414 436 2.09e-3 SMART
ZnF_C2H2 442 464 4.79e-3 SMART
ZnF_C2H2 470 492 2.2e-2 SMART
ZnF_C2H2 498 520 4.47e-3 SMART
ZnF_C2H2 526 548 4.72e-2 SMART
ZnF_C2H2 554 576 1.28e-3 SMART
ZnF_C2H2 583 605 5.06e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173151
Predicted Effect probably benign
Transcript: ENSMUST00000174417
SMART Domains Protein: ENSMUSP00000134459
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
Blast:KRAB 1 38 5e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174512
SMART Domains Protein: ENSMUSP00000133873
Gene: ENSMUSG00000055240

DomainStartEndE-ValueType
KRAB 10 62 9.34e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183047
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.7%
Validation Efficiency 100% (100/100)
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T A 6: 146,952,404 M252L probably benign Het
Abca6 A G 11: 110,236,789 V314A probably benign Het
Abcb1b A T 5: 8,827,409 E656D probably benign Het
Abhd4 T C 14: 54,263,234 I160T probably benign Het
Aco2 T C 15: 81,889,356 V32A probably damaging Het
Actl6b A G 5: 137,554,144 probably benign Het
Akap13 T C 7: 75,736,604 probably benign Het
Alpk3 A T 7: 81,076,974 T136S probably benign Het
Ap1g1 G T 8: 109,803,117 M56I probably benign Het
Arid2 C T 15: 96,370,571 T855I probably damaging Het
Asprv1 T C 6: 86,629,095 F308L probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp11b T A 3: 35,812,110 M378K possibly damaging Het
Atp1a3 T C 7: 24,981,512 probably benign Het
Blk C A 14: 63,380,804 A218S probably benign Het
C4b T A 17: 34,734,776 T953S probably benign Het
Cdadc1 T C 14: 59,575,907 probably benign Het
Cdca2 C A 14: 67,677,178 L877F probably damaging Het
Ceacam10 G T 7: 24,778,308 V83L probably damaging Het
Cep290 A T 10: 100,514,574 I677F probably benign Het
Clip1 A T 5: 123,617,332 probably benign Het
Col11a2 G T 17: 34,064,803 probably benign Het
Coro1c A T 5: 113,845,252 V405D probably benign Het
Crebrf A G 17: 26,739,594 T13A probably benign Het
Cspg4 A G 9: 56,897,410 E1835G probably damaging Het
Cubn T C 2: 13,424,694 N1332S probably benign Het
Cubn T C 2: 13,440,514 T1014A possibly damaging Het
Cubn A T 2: 13,476,035 probably null Het
Efnb1 T C X: 99,137,028 probably benign Het
Elf2 G T 3: 51,308,190 P33Q probably damaging Het
Fap C T 2: 62,503,402 G633D probably damaging Het
Gm10288 T C 3: 146,838,920 noncoding transcript Het
Gm14139 G A 2: 150,191,864 R35K possibly damaging Het
Gm7714 A T 5: 88,282,371 H42L possibly damaging Het
Got2 T C 8: 95,869,538 N318S probably benign Het
Guk1 A T 11: 59,186,028 F76L probably damaging Het
H2-K1 A T 17: 33,996,665 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hinfp G A 9: 44,298,239 H250Y probably damaging Het
Hnrnpm C T 17: 33,652,268 probably null Het
Hsd11b2 T A 8: 105,523,067 V270E possibly damaging Het
Igbp1b A T 6: 138,658,203 M81K probably damaging Het
Kif11 A G 19: 37,411,509 T815A probably benign Het
Kit G A 5: 75,620,921 V337I probably benign Het
Klf11 T C 12: 24,653,583 S6P probably damaging Het
Klk13 T C 7: 43,723,821 V193A probably benign Het
Krt73 T A 15: 101,799,889 probably benign Het
L1td1 T A 4: 98,737,182 L538* probably null Het
Macf1 A G 4: 123,432,779 L2061P probably damaging Het
Mcm2 A G 6: 88,884,016 I900T probably damaging Het
Med16 A T 10: 79,900,200 N371K possibly damaging Het
Mepce A C 5: 137,785,436 D209E possibly damaging Het
Mrc2 C G 11: 105,347,866 P1249R probably benign Het
Mx2 A T 16: 97,556,095 I463L probably benign Het
Naaa A T 5: 92,265,135 N73K probably damaging Het
Nags T A 11: 102,147,945 L404Q probably damaging Het
Neb A G 2: 52,243,390 Y3379H probably damaging Het
Nhsl1 A G 10: 18,472,985 E120G probably damaging Het
Olfr1276 A C 2: 111,257,121 N2T probably benign Het
Olfr561 C A 7: 102,774,869 S115* probably null Het
Olfr615 T A 7: 103,560,622 Y48* probably null Het
Olfr643 T C 7: 104,059,521 H27R probably benign Het
Olfr736 T C 14: 50,393,079 S108P probably damaging Het
Pcnt A G 10: 76,392,580 F1584L probably benign Het
Pdgfra G A 5: 75,167,935 V243I probably damaging Het
Polr2a T C 11: 69,743,671 I689V possibly damaging Het
Ppfia4 C A 1: 134,324,224 probably benign Het
Prmt8 C A 6: 127,711,808 V200L probably damaging Het
Prpf8 T A 11: 75,506,362 I2007N possibly damaging Het
Ptpn6 T C 6: 124,728,150 E230G probably damaging Het
R3hcc1l G A 19: 42,563,148 V195I probably damaging Het
Rb1cc1 C T 1: 6,262,847 T1330I probably damaging Het
Reep3 G T 10: 67,021,796 T172N probably benign Het
Rfwd3 A G 8: 111,294,023 V236A probably benign Het
Rgs22 T C 15: 36,104,552 I121V probably damaging Het
Robo1 T A 16: 72,664,170 F11I probably benign Het
Rsrc2 A G 5: 123,740,847 probably benign Het
Rubcn A G 16: 32,847,946 V117A probably benign Het
Scamp1 T G 13: 94,210,580 N192T probably benign Het
Scn8a T A 15: 101,018,364 I1218N probably damaging Het
Serinc1 A G 10: 57,523,208 S200P probably damaging Het
Serpinb9f T A 13: 33,334,591 F358Y probably damaging Het
Slc12a5 T C 2: 164,997,245 probably null Het
Slc5a4b T C 10: 76,070,628 M386V possibly damaging Het
Smarca5 A G 8: 80,704,700 F963L probably benign Het
Smchd1 A T 17: 71,411,891 F828I probably benign Het
Stab2 G T 10: 86,897,960 Q1333K probably benign Het
Svop T C 5: 114,038,539 S349G probably benign Het
Tdrd1 G A 19: 56,842,566 S271N probably benign Het
Tec T C 5: 72,763,556 probably benign Het
Tec G A 5: 72,783,738 P159S probably benign Het
Tfip11 G A 5: 112,335,655 M645I probably benign Het
Thap12 A T 7: 98,715,281 T219S probably benign Het
Tmem87a C T 2: 120,375,507 R329H probably damaging Het
Tpsab1 A G 17: 25,343,745 Y227H probably damaging Het
Urah G A 7: 140,837,689 V114I probably benign Het
Wnt5a G A 14: 28,522,854 E353K probably damaging Het
Other mutations in Zfp101
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0189:Zfp101 UTSW 17 33382239 missense possibly damaging 0.53
R0448:Zfp101 UTSW 17 33382321 missense possibly damaging 0.73
R0696:Zfp101 UTSW 17 33381427 missense possibly damaging 0.86
R0834:Zfp101 UTSW 17 33382444 missense probably benign 0.33
R2000:Zfp101 UTSW 17 33381517 missense possibly damaging 0.92
R2366:Zfp101 UTSW 17 33380998 missense probably benign 0.06
R2471:Zfp101 UTSW 17 33380976 missense possibly damaging 0.85
R3713:Zfp101 UTSW 17 33381906 missense probably benign 0.05
R3857:Zfp101 UTSW 17 33382431 nonsense probably null
R4537:Zfp101 UTSW 17 33382492 missense possibly damaging 0.87
R4712:Zfp101 UTSW 17 33394483 splice site probably null
R5049:Zfp101 UTSW 17 33381898 missense possibly damaging 0.71
R5241:Zfp101 UTSW 17 33382236 missense probably benign
R5499:Zfp101 UTSW 17 33382344 missense probably benign 0.20
R5587:Zfp101 UTSW 17 33381321 missense possibly damaging 0.71
R5694:Zfp101 UTSW 17 33380945 missense probably benign
R5994:Zfp101 UTSW 17 33380962 missense probably benign
R6193:Zfp101 UTSW 17 33381746 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAATAAAGGCAAGTTGACCACACAGT -3'
(R):5'- GGAGACAAGCCATATTCATGCACACATT -3'

Sequencing Primer
(F):5'- ATGGGATGTAGGACCCAGAA -3'
(R):5'- tcaagtgcccgcaacag -3'
Posted On2013-05-09