Incidental Mutation 'R4621:Angptl1'
ID346120
Institutional Source Beutler Lab
Gene Symbol Angptl1
Ensembl Gene ENSMUSG00000033544
Gene Nameangiopoietin-like 1
SynonymsANGPT3, ANG-3, ANG3, 2810039D03Rik, ANGY, ARP1, ANG3
MMRRC Submission 041886-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4621 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location156838562-156861078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 156844924 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 107 (V107M)
Ref Sequence ENSEMBL: ENSMUSP00000107349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027885] [ENSMUST00000027886] [ENSMUST00000063199] [ENSMUST00000111720] [ENSMUST00000171292] [ENSMUST00000172057] [ENSMUST00000185198] [ENSMUST00000188656] [ENSMUST00000189316] [ENSMUST00000190648] [ENSMUST00000191605] [ENSMUST00000192343]
Predicted Effect probably damaging
Transcript: ENSMUST00000027885
AA Change: V107M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027885
Gene: ENSMUSG00000033544
AA Change: V107M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
FBG 274 489 1.3e-99 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000027886
SMART Domains Protein: ENSMUSP00000027886
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 439 552 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063199
SMART Domains Protein: ENSMUSP00000063872
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111720
AA Change: V107M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107349
Gene: ENSMUSG00000033544
AA Change: V107M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171292
SMART Domains Protein: ENSMUSP00000130581
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172057
SMART Domains Protein: ENSMUSP00000132533
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
RasGEF 5 253 1.35e-83 SMART
low complexity region 359 382 N/A INTRINSIC
PH 430 543 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185198
SMART Domains Protein: ENSMUSP00000139618
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
Blast:PH 465 562 3e-55 BLAST
PDB:2DTC|B 466 551 9e-34 PDB
SCOP:d1btn__ 467 546 2e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188656
SMART Domains Protein: ENSMUSP00000140342
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189316
SMART Domains Protein: ENSMUSP00000140230
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PDB:2DTC|B 466 520 6e-16 PDB
SCOP:d1btn__ 467 519 1e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190648
SMART Domains Protein: ENSMUSP00000140055
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 1.4e-93 SMART
low complexity region 394 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191605
SMART Domains Protein: ENSMUSP00000139645
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
low complexity region 18 37 N/A INTRINSIC
RasGEF 45 288 2.31e-91 SMART
low complexity region 394 417 N/A INTRINSIC
PH 465 578 1.01e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192343
SMART Domains Protein: ENSMUSP00000142004
Gene: ENSMUSG00000026594

DomainStartEndE-ValueType
SCOP:d1bkds_ 1 70 3e-5 SMART
PDB:3QXL|B 38 71 3e-14 PDB
Blast:RasGEF 45 74 1e-11 BLAST
Meta Mutation Damage Score 0.0408 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiopoietins are members of the vascular endothelial growth factor family and the only known growth factors largely specific for vascular endothelium. Angiopoietin-1, angiopoietin-2, and angiopoietin-4 participate in the formation of blood vessels. The protein encoded by this gene is another member of the angiopoietin family that is widely expressed in adult tissues with mRNA levels highest in highly vascularized tissues. This protein was found to be a secretory protein that does not act as an endothelial cell mitogen in vitro. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no detectable phenotypic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik G A 1: 43,737,252 probably null Het
Abhd2 T C 7: 79,325,487 Y142H probably damaging Het
Abra C T 15: 41,869,224 D149N probably benign Het
Acin1 A T 14: 54,653,443 probably benign Het
Adap2 T A 11: 80,174,073 probably null Het
Afdn A G 17: 13,888,820 E1535G probably damaging Het
Ak9 A G 10: 41,406,891 N1218D possibly damaging Het
Arhgap26 G A 18: 38,899,841 probably benign Het
Cage1 A C 13: 38,025,501 S61A possibly damaging Het
Cdadc1 T C 14: 59,586,555 T163A probably benign Het
Celsr2 A T 3: 108,395,216 V2568D possibly damaging Het
Cep44 G A 8: 56,542,916 T166M probably damaging Het
Cnksr3 T C 10: 7,126,182 K187E possibly damaging Het
Cyp20a1 A G 1: 60,376,099 T295A probably benign Het
Dus2 T A 8: 106,030,442 M88K probably damaging Het
E330034G19Rik A T 14: 24,296,002 probably benign Het
Efna5 T C 17: 62,651,045 D72G probably benign Het
Epb41l2 T C 10: 25,502,140 probably null Het
Espn A G 4: 152,131,252 S408P probably damaging Het
Evi5l T C 8: 4,202,909 probably benign Het
F830016B08Rik G A 18: 60,300,867 V341I probably benign Het
Flii A G 11: 60,716,111 L1013P possibly damaging Het
Fndc10 G A 4: 155,694,807 V103M probably damaging Het
Frem3 T A 8: 80,669,191 probably null Het
Gltp C T 5: 114,674,127 R106Q probably damaging Het
Gm7102 C T 19: 61,175,926 G24R unknown Het
Gm996 G A 2: 25,578,400 P500S probably damaging Het
Gtf3c3 A G 1: 54,419,416 Y449H probably damaging Het
Hils1 G A 11: 94,968,160 V94M probably damaging Het
Hmga1b T C 11: 120,763,040 V51A probably damaging Het
Hsph1 A G 5: 149,618,843 V705A probably benign Het
Igkv13-84 T C 6: 68,939,799 S27P possibly damaging Het
Il15ra A G 2: 11,718,329 N55D possibly damaging Het
Kctd19 T G 8: 105,396,471 N104H probably damaging Het
Kif27 T G 13: 58,331,013 D572A probably benign Het
Larp1b G A 3: 40,963,989 G22R possibly damaging Het
Lcn2 A T 2: 32,384,643 probably benign Het
Lmtk2 T A 5: 144,174,934 I824N probably benign Het
Ltbp2 A G 12: 84,809,348 I707T probably damaging Het
Macf1 A G 4: 123,372,348 probably null Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mcoln1 A G 8: 3,505,923 I73V probably damaging Het
Mycbp2 G T 14: 103,219,979 T1627K probably benign Het
Myh8 A G 11: 67,286,258 E412G probably damaging Het
Myo9a T A 9: 59,871,072 D1370E probably benign Het
Ndufaf5 A G 2: 140,183,925 T135A probably benign Het
Neb G A 2: 52,271,039 Q2207* probably null Het
Nek3 T C 8: 22,157,039 Y160C probably damaging Het
Olfr1371 G C 11: 52,213,879 L37V probably benign Het
Olfr175-ps1 A T 16: 58,824,106 I201N possibly damaging Het
Osbpl8 A G 10: 111,269,418 I245V probably benign Het
Pcdh9 T C 14: 93,887,643 I241V probably benign Het
Pcdhb12 A G 18: 37,437,160 Q453R probably benign Het
Pcdhb2 A G 18: 37,295,927 T318A probably benign Het
Prlr T A 15: 10,319,376 probably benign Het
Ptprz1 C T 6: 23,001,454 A1181V possibly damaging Het
Racgap1 C A 15: 99,626,206 S440I probably benign Het
Rap1gap2 A G 11: 74,435,699 probably null Het
Rbm5 A G 9: 107,754,146 V244A probably damaging Het
Rexo5 T G 7: 119,819,499 I254R probably benign Het
Robo2 A T 16: 73,985,933 S316T probably benign Het
Satb2 A T 1: 56,845,619 V382E probably damaging Het
Scg2 C T 1: 79,436,664 R114Q probably benign Het
Scube2 T C 7: 109,800,650 D893G possibly damaging Het
Snrpn T C 7: 59,987,526 D14G possibly damaging Het
Spag17 A G 3: 100,103,243 T2018A probably benign Het
Spata9 T G 13: 75,967,882 F17V possibly damaging Het
Supt6 A G 11: 78,212,746 Y1378H possibly damaging Het
Thsd7b T C 1: 129,430,915 S29P possibly damaging Het
Tmem59 A T 4: 107,190,718 probably benign Het
Tmem87a A G 2: 120,397,424 S81P probably benign Het
Togaram1 A T 12: 64,982,450 E882D possibly damaging Het
Trbj2-4 T A 6: 41,543,374 probably benign Het
Trim42 T A 9: 97,363,148 Y533F probably benign Het
Tssk5 C T 15: 76,372,468 R280Q probably benign Het
Vmn1r82 A G 7: 12,305,336 T179A possibly damaging Het
Yipf7 T A 5: 69,519,361 Q145L possibly damaging Het
Other mutations in Angptl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02835:Angptl1 UTSW 1 156858520 missense probably benign 0.22
R0285:Angptl1 UTSW 1 156845215 missense probably benign 0.00
R1237:Angptl1 UTSW 1 156858584 missense probably damaging 1.00
R1573:Angptl1 UTSW 1 156857170 missense possibly damaging 0.81
R1722:Angptl1 UTSW 1 156857085 missense possibly damaging 0.87
R4795:Angptl1 UTSW 1 156860583 missense possibly damaging 0.88
R4849:Angptl1 UTSW 1 156857165 missense probably benign 0.01
R4915:Angptl1 UTSW 1 156844818 missense probably benign
R5919:Angptl1 UTSW 1 156858546 missense probably damaging 1.00
R6656:Angptl1 UTSW 1 156857236 missense probably damaging 1.00
R6833:Angptl1 UTSW 1 156844693 missense probably benign 0.04
R6834:Angptl1 UTSW 1 156844693 missense probably benign 0.04
X0066:Angptl1 UTSW 1 156844935 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATATCCCCGTGCTACTGATGG -3'
(R):5'- CATCTTCAGCATTTCTGTGGTG -3'

Sequencing Primer
(F):5'- CCCGTGCTACTGATGGGAAAG -3'
(R):5'- GACATTGAGGATTTTGTTTTCCAGC -3'
Posted On2015-09-25